1.
2 ¿Cómo viajan?
Elige.
Select the vocabulary word that best completes each sentence.
2.
3.
4.
N
5.
Queremos ir de viaje a Australia. Tenemos que ir en
Camila y sus tíos van de
Tomamos un
Tienen un
Muchos estudiantes van a la escuela en
. Les gusta viajar.
para ir del aeropuerto al hotel.
nuevo. Está en el garaje de su casa.

Answers

Answer 1

De acuerdo con la información podemos inferir que las palabras que completan las oraciones son: avión, coche/auto, taxi, autobús.

¿Cómo completar las oraciones?En la oración "Queremos ir de viaje a Australia. Tenemos que ir en ______ para ir del aeropuerto al hotel", la palabra que mejor completa la frase es "avión", ya que es el medio de transporte más comúnmente utilizado para viajar a largas distancias internacionales.En la oración "Camila y sus tíos van de ______. Les gusta viajar", la palabra que mejor completa la frase es "coche" o "auto", ya que indica que ellos viajan en su propio vehículo privado.En la oración "Tomamos un ______. Está en el garaje de su casa", la palabra que mejor completa la frase es "taxi", ya que indica que tomaron un servicio de transporte público pagado para llegar a su destino.En la oración "Muchos estudiantes van a la escuela en ______", la palabra que mejor completa la frase es "autobús", ya que es un medio de transporte comúnmente utilizado por estudiantes para desplazarse hacia y desde la escuela.

Aprende sobre oraciones en: https://brainly.com/question/28325101
#SPJ1


Related Questions

3. Enrique comió en el restaurante Mar de las Antillas. →.

Answers

Enrique eats in the mar de las Antillas restaurant

1. Para el año que viene, Alejandro ya______un aumento de sueldo. 2. María ya______sus estudios de arquitectura. 3. Y tú_____una empresa con ella. 4. Alejandro y María_____su boda. 5. Ellos nos______a todos para la celebración. 6. El padre de María_____mucho éxito en su nuevo trabajo. 7. Y él ya les_____el viaje de novios. 8. Para entonces, todos nosotros ya les_____el regalo. 9. Alejandro y María______una casa. 10. Ellos necesitarán mucho dinero y_____un préstamo al banco

Answers

Answer:

tendrá

tuvo

tienes

tienen

traeran

tiene

tenia

teniamos

tendran

tienen


HELP
Cuando José visita a sus tíos, muchas cosas pasan.
Describe lo que pasa, completando las siguientes
oraciones con la forma apropiada de los verbos entre
paréntesis.

Answers

Answer:

Lo siento, pero no puedo completar la tarea sin la información de las oraciones que deben ser completadas. Por favor, proporciona las oraciones para que pueda ayudarte mejor. Como tutor de Brainly, mi tarea es responder a preguntas específicas y proporcionar explicaciones claras y precisas.

Explanation:

(01.05 MC)
Match each sentence with the type of error or errors you see in each.
Match

A)word missing accent mark
B) Unnecessary capitalization
C) Word needs capitalization
D) Misspelled word

1.
El dia 14 de mayo es tu quinceañera! Tienes la A) Word missing accent mark
fiesta el dia 14 de mayo. La quinceañera es una
fiesta bonita.
2.
Yo tengo el pelo castaño y soy baja. ¿Cómo
erres? ¿Erres alta o baja, rubia o pelirroja?
3.
La fiesta de Rosa y Javier es el trece de
Septiembre. Es el Jueves. Tengo la dirección de
correo electrónico de Rosa, pero no tengo la
dirección de Javier.
4.
Maribel, tú eres Bonita y guapa. Tienes 28 años y eres de Lima, perú.

Answers

Answer:

1. a

2. d

3. b [dont capitalize months, days of the week]

4. c

What is the subject, the direct object pronoun, and indirect object pronoun in a sentence

Answers

The subject refers to the entity performing the action, while the direct and indirect objects refer to the entities affected by the action.

How are each of the elements used?Subject: This is defined as the entity of the action, which is why it is placed before the verb. It can be a person but also a place, an animal, or even a concept.Direct object pronoun: This refers to the pronoun directly affected by the action performed.Indirect object pronoun: This is the entity that receives the direct object or it is benefited from the action.

An example is:

Anna (subject) bought it (direct object pronoun) for him  (indirect object pronoun)

Learn more about the subject in https://brainly.com/question/3541306

#SPJ1

¿Qué hizo Andrés este verano?
a. Lee el blog de Andrés, que te invita a compartir información con él.
b. Anota lo que hizo Andrés este verano y lo que te preguntó a ti.
c. A continuación, vad a poder contestar a sus preguntas en su blog. ​

Answers

De acuerdo con la información podemos inferir que Andrés este verano fue de paseo a la playa con su familia. Adicionalmente, dice que sus amigos están de viae como él.

¿De qué se trata el blog de Andrés?

Andrés escribe en su blog que fue de paseo a la playa con su familia y que puede ver las vacaciones de sus amigos por medio de las redes sociales.

También nos pregunta sobre qué hicimos nosotros en nuestras pasadas vacaciones y qué fue lo que más nos gustó. En este caso podríamos responderle que lo que más nos gustó fue descansar de la escuela y pasar tiempo con nuestra familia.

Nota: Esta pregunta está incompleta. Aquí está la información completa:

Imagen anexada

Aprenda más sobre blogs en: https://brainly.com/question/19671382
#SPJ1

¿Q significa connotativamente la palabra península ?

Answers

El significado connotativo de la palabra península está relacionado con la belleza natural pero también con un lugar aislado.

¿Cuál es el significado connotativo de la palabra península?

El significado connotativo difiere del significado denotativo ya que no se refiere a la definición dada por la RAE sino a ideas que se han construido culturalmente en relación a las palabras. En el caso de península hay dos significados asociados:

Belleza natural: Las penínsulas se asocian con la selva y con un destino turístico exótico.Lugar aislado: También se relacionan con lugares de muy difícil acceso e incluso peligrosos.

Aprenda más sobre significado en https://brainly.com/question/23273304

#SPJ1

Sinónimo de ocurrir

Answers

un sinónimo de ocurrir es suceder.
Algunos sinónimos de ocurrir son acaecer, acontecer, suceder, sobrevenir, y pasar.

espero que esto te ayude perdón si no es la respuesta que buscabas

Isabel las pinturas en el museo

Answers

This means “Isabel the paintings in the museum.”
However this doesn’t make sense so what I think you’re looking for is “Isabel verá las pinturas en el museo,” which means “Isabel will see the pictures in the museum.”

Answer:

- observa.

Explanation:

- Isabel observa las pinturas en el museo.

...

Describe a day in the life of a media professional, such as a journalist, a reporter, or an editor. Include information about the roles and responsibilities that the job entails. Please type your response in Spanish

Answers

Answer:

Un día en la vida de un profesional de medios de comunicación, como un periodista, reportero o editor, puede variar dependiendo de la organización para la que trabajen y el tipo de noticias o historias que cubran.

Por lo general, el día comienza con la revisión de las noticias más recientes y la discusión con otros miembros del equipo sobre los temas más importantes del día. Luego, el periodista o reportero podría salir a cubrir una historia: entrevistar a personas, hacer fotografías o enviar información en tiempo real a través de redes sociales.

Una vez que la historia se ha recolectado, el editor podría revisar y hacer ajustes finales antes de publicarla en línea o en la edición impresa. Los editores también pueden ser responsables de asignar historias a los miembros del equipo y coordinar las tareas del personal.

En algunas organizaciones, los profesionales de los medios también pueden estar involucrados en la creación de contenido multimedia, como videos y podcast, para complementar la cobertura noticiosa.

A medida que el panorama de los medios de comunicación continúa evolucionando, los profesionales de los medios deben seguir siendo ágiles en su capacidad para adaptarse y abordar los cambios, mientras continúan manteniendo los altos estándares éticos y profesionales que son fundamentales en su trabajo.

Explanation:

you might want to use a paraphraser app just in case but there u go

SPANISH HELP!!

1. Conjugate the verb as a negative informal command: practicar

2. Conjugate the verb as a negative informal command: hacer

3. Conjugate the verb as an affirmative informal command: compartir

4. Conjugate the verb as an affirmative informal command: poner

Answers

Based on the information provided, the commands are no practiques, no hagas, comparte and pon.

How to write commands?

Remember that commands are instructions or orders that are usually short but clear. In Spanish, there are two ways of writing commands:

Formal - This is based on the use of usted, which is the formal use of "you". For example: vaya al supermercado o llame después de las 10 a.m.Informal - This is based on the use of tú, which is the informal use of "you". For example: ve al supermerceado o llama después de las 10 a.m.

Both of these are possible but informal commands are used with friends and family.

Learn more about commands in https://brainly.com/question/32329589

#SPJ1

Compare these two pictures of two different kitchens using the appropriate vocabulary. Imagine the first one is your kitchen and the second one is your friend's kitchen. Write five sentences in Spanish that highlight the differences between the two kitchens.

Answers

Answer:

Mi cocina es más moderna que la cocina de mi amigo.

Mi cocina está decorada; la cocina de mi amigo no lo es.

Tengo gabinetes blancos y mi amigo tiene gabinetes marrones.

Mi cocina es azul y blanca. La cocina de mi amigo es marrón y blanca.

Hay más iluminación natural en mi cocina mientras que en la cocina de mi amigo hay más iluminación artificial.

¿Cómo se conectan los 5 sentidos humanos con el pasaje “diles que no me maten” de Juan Rulfo? (por favor explique específicamente y separar las partes de cada sentido de los seres humanos.)

Answers

De acuerdo con el pasaje se utiliza la descripción sensorial para sumergir al lector en la escena y evocar una respuesta emocional.

¿Cómo se conectan los 5 sentidos humanos con el pasaje?

En el pasaje "Diles que no me maten" de Juan Rulfo, los sentidos humanos se conectan de la siguiente manera:

Vista: El sentido de la vista se activa al describir los elementos visuales del entorno, como el paisaje, la luz, las personas y la muerte inminente del personaje principal.Oído: Se utiliza el sentido del oído para percibir los sonidos del entorno, como las palabras de los personajes y los gritos de la gente.Tacto: A través de la descripción táctil, se puede sentir la aspereza del terreno, el calor del sol y la textura del cuerpo del personaje.Gusto: Aunque el sentido del gusto no se menciona específicamente en este pasaje, se puede inferir la sensación de amargura o tristeza asociada con la inminente ejecución.Olfato: Aunque no se describe directamente en el pasaje, se puede imaginar el olor del entorno rural, como la tierra, el polvo o el sudor.

Aprenda más sobre sentidos humanos en: https://brainly.com/question/22484904
#SPJ1


HELP
¿Qué van a hacer las siguientes personas después de levantarse, según las indicaciones?

Answers

1. van a cepillarse el pelo
2. voy a desayunar
3. vamos a ducharnos
4. van a afeitarse
5. vas a leer el periódico
6. va a maquillarse
7. va a preparar el desayuno
8. van a vestirse

1. What are the current events in the news? How you feel abouta particular event, Such as government issues, war, world events, major weather, etc.

2. What types of television shows do you like to watch? which do you not like to watch?

3. What types of music do you like and why?

Answer questions only in Spanish. ​

Answers

To answer such questions in Spanish, you must correctly use the vocabulary and grammar in the language, so that there is cohesion and coherence in the sentences.

How to learn Spanish?

The student must constantly study and carry out activities that help in the development of listening, writing, speaking and reading skills. Thus, we can answer sentences such as:

Un hecho actual en las noticias es el uso de la inteligencia artificial, lo que puede generar preocupación en las personas con el desarrollo actual de la tecnología.Los programas de televisión que me gusta ver son educativos, que transmiten nuevas ideas y estimulan el conocimiento.El tipo de música que me gusta escuchar es la música regional, que me informa mejor sobre la cultura local.

Therefore, this is a positive activity that help in improvement of knowledge in spanish language.

Find out more about spanish vocabulary at:

https://brainly.com/question/26522612

#SPJ1


HELP
Cuando José visita a sus tíos, muchas cosas pasan. Describe lo que pasa, completando las
siguientes oraciones con la forma apropiada de los verbos entre paréntesis.

Answers

De acuerdo con la información podemos inferir que los verbos que completan las oraciones son: van, le pregunta, se duerme, lleva, se lleva, comen, se pregunta, se comen.

¿Cómo completar las oraciones con los verbos adecuados?

De acuerdo con la información podemos inferir que las oraciones correctas quedarían así:

Todos van al lago a las cinco y media de la mañana.Raúl siempre le pregunta a José todo lo que él sabe sobre cómo pescar.José se duerme temprano para despertarse temprano.La tía lleva a los chicos en su carro nuevo.José se lleva muy  bien con Raúl.Ellos comen perros calientes.La tía de José siempre se pregunta a qué hora van a volver de pescar.A la hora de la comida, José y sus primos se comen todo el pescado.

Aprenda más sobre oraciones en: https://brainly.com/question/28325101
#SPJ1

Romina y David pagaste la cena.
Romina y David pagasteis la cena.
O Romina y David paguieron la cena.
O Romina y David pagaron la cena.

Answers

The last one/ la última
Romina y David pagaron la cena.

Que significa connotativamente las palabras península,Germen,venero,transijo

Answers

De acuerdo con la información los términos tienen diferentes significados connotativo.

¿Qué significados connotativos tienen estos términos?Península: Representa la idea de aislamiento o separación, ya que una península es una extensión de tierra rodeada de agua por tres de sus lados. En sentido connotativo, puede evocar la sensación de estar apartado o distanciado de algo o alguien.Germen: Sugiere la idea de inicio o principio, como el punto de partida de algo. Connotativamente, puede expresar el potencial de crecimiento, desarrollo o cambio.Venero: Evoca la noción de fuente o manantial, especialmente de algo positivo o valioso. En sentido connotativo, puede denotar la fuente de inspiración, energía o vitalidad.Transijo: Indica la disposición a ceder o aceptar algo, a llegar a un acuerdo o compromiso. Connotativamente, puede reflejar una actitud de flexibilidad, adaptabilidad o conciliación en una situación conflictiva.

Aprenda más sobre connotativos en: https://brainly.com/question/24121482
#SPJ1


Yo
type your answer....
idealista.

Answers

The words that can be used to complete this sentence are "soy una persona", and the complete sentence would be "Yo soy una persona idealista".

How to complete this sentence?Identify the word that is missing, for example, if the word that is missing is an adverb or a verb. In this case, we only have a subject which is "yo" and a complement, which is "idealista"; however we do not have a verb.Based on this, choose an appropriate verb, which in this case is the verb to be as we are talking about personal qualities.Complete the sentence and add other words if necessary.

Learn more about sentences in https://brainly.com/question/27752686

#SPJ1

SPANISH HELP!!

Imagine you’re babysitting a sibling or neighbor. Write 6 complete sentences in Spanish to say what commands you would give the child while watching him or her. Use 3 affirmative informal commands and 3 negative informal commands. Each sentence is worth 2 points: 1 for a complete sentence in Spanish, and 1 for a correctly conjugated command.

Answers

We can write complete sentences in Spanish to say what commands a babysitter would give to the child while watching, with informal affirmative and negative commands like this:

Guarda tus juguetes.Haz tu tarea.Come tu almuerzo.No andes descalzo.No comas estos dulces antes del almuerzo.No pases tanto tiempo en tu celular.What is the imperative mood?

It corresponds to a verbal mood that is mainly used to give orders, advice or requests to someone. In Spanish, there are affirmative and negative forms, whose conjugation will be given in the present tense.

Therefore, it is essential that you make your recommendations to the interlocutor using the correct imperative forms, with the correct conjugations of the verb and pronouns according to Spanish grammar.

Find out more about Spanish verbs at:

https://brainly.com/question/7150507

#SPJ1

en el lazarillo de tormes, los personajes son mostrados por los ojos del protagonista o en forma objetiva?

Answers

En "La vida de Lazarillo de Tormes" los personajes se muestran a través de los ojos del protagonista de la narración.

¿Cuál es la trama de la historia?

La narración se cuenta desde la perspectiva del personaje central que da nombre al título, Lázaro, quien cuenta sus vivencias en una autobiografía, retratando sus dificultades, desafíos, emociones y sentimientos en las diferentes etapas de la vida.

Por lo tanto, como la narración es asumida por el personaje principal, no podemos decir que está narrada desde una perspectiva objetiva, ya que está impactada por cuestiones subjetivas derivadas de la visión de los hechos por parte del personaje.

Encuentra más sobre narración en:

https://brainly.com/question/75925

#SPJ1

(01.05 MC)
Match each sentence with the type of error or errors you see in each.
Match

A)word missing accent mark
B) Unnecessary capitalization
C) Word needs capitalization
D) Misspelled word

1.
El dia 14 de mayo es tu quinceañera! Tienes la A) Word missing accent mark
fiesta el dia 14 de mayo. La quinceañera es una
fiesta bonita.
2.
Yo tengo el pelo castaño y soy baja. ¿Cómo
erres? ¿Erres alta o baja, rubia o pelirroja?
3.
La fiesta de Rosa y Javier es el trece de
Septiembre. Es el Jueves. Tengo la dirección de
correo electrónico de Rosa, pero no tengo la
dirección de Javier.
4.
Maribel, tú eres Bonita y guapa. Tienes 28 años y eres de Lima, perú.

Answers

Answer is A m. Word missing accent mark

Answer:

1. A)word missing accent mark

El dia 14 de mayo es tu quinceañera! Tienes la fiesta el dia 14 de mayo. La quinceañera es una

fiesta bonita.

2. D) Misspelled word

Yo tengo el pelo castaño y soy baja. ¿Cómo

erres? ¿Erres alta o baja, rubia o pelirroja?

3. B) Unnecessary capitalization

La fiesta de Rosa y Javier es el trece de

Septiembre. Es el Jueves. Tengo la dirección de

correo electrónico de Rosa, pero no tengo la

dirección de Javier.

4. C) Word needs capitalization

Maribel, tú eres Bonita y guapa. Tienes 28 años y eres de Lima, perú.

Explanation:

I'm Peruvian, Spanish is spoken here xd

Which island belongs to Chile?

Answers

Answer:Easter Island

Explanation:Is an island and special territory of Chile in the southeastern Pacific Ocean, at the southeasternmost point of the Polynesian Triangle in Oceania.

Answer:

Easter Island, Spanish Isla de Pascua, also called Rapa Nui, Chilean dependency in the eastern Pacific Ocean.

porqué crees que martha reacciono asi frente al comportamiento de su hermana



Answers

Luke 10:38-42 tells of Jesus at Martha and Mary's house. Martha asks Jesus to ask Mary to help her. Martha's reaction is due to her desire to fulfill hospitality duties. She may have felt overwhelmed and seen Mary's choice to listen as neglectful.

What is Luke 10, 38 – 42  about?

Do you find Mary's attitude unacceptable?

Jesus approves of her choice to listen to his teachings. Jesus does not find Mary's attitude unacceptable. Note that interpretations may exist that argue Mary should have helped Martha with household tasks. Jesus tells Martha to focus on the one necessary thing amidst her anxiety and troubles.

How does this relate to women today?

Jesus redirects Martha to prioritize spiritual nourishment and time with him, praising Mary's choice. 5-5 This message is relevant to women today. Women, like Martha, can feel overwhelmed and anxious due to their responsibilities. Jesus' words remind to prioritize relationship and seek spiritual nourishment. "Balance is key.

Learn more about Jesus  from

https://brainly.com/question/510889

#SPJ1

Analiza el texto de Lucas 10, 38 – 42 y resuelve las siguientes preguntas: a) ¿Por qué crees que Marta reaccionó así frente al comportamiento de su hermana? b) ¿Crees que la actitud de María es reprochable? ¿Por qué? c) Explica lo que quiso decir Jesús a marta con su respuesta. Luego, compáralo con la vida de la mujer actual.

Luke 10, 38 – 42 and solve the following questions: a) Why do you think Marta reacted like this to the behavior of your sister? b) Do you think that Maria's attitude is reprehensible? Because? c) Explain what Jesus meant to Martha with his answer. Then compare it to the life of the current woman.

¿Dónde están muchos de los centros comerciales?

Answers

Answer:

The Mall of America is the biggest mall

Read the sentence in English, and then choose the sentence in Spanish that expresses the same meaning.

Marsha's mom is worried about Marsha walking on the road on her way to school. What can she tell Marsha?

A.) Caminar por la carretera es más peligroso que caminar por el puente de peatones.
B.) Caminar por el puente de peatones es tan peligroso como caminar por la carretera.
C.) El puente de peatones es más peligroso que la carretera.
D.)La carretera no es tanto peligrosa como el puente de peatones.

Answers

Is A

A.) Caminar por la carretera es más peligroso que caminar por el puente de peatones.
The answer is letter A caminar por la carretera es más peligroso que caminar por el puente de peatones

Decide whether the command is grammatically CORRECT or INCORRECT as written.

Corres rápidamente.

correct
incorrect

Answers

This was incorrect because the way it’s said is like a question and not like a normal sentence
Incorrect because you basically said do “you run fast”

Ensayo violencia barrista en el paisaje futbolero colombiano

Answers

Answer: Trial of neighborhood violence in the Colombian football landscape

Explanation: I'm pretty sure that's the correct translation.

¿Por qué se puede decir que el teatro medieval español es una copia del teatro francés?

Answers

Se puede decir que el teatro medieval español es una copia del teatro francés porque tiene múltiples influencias y similitudes con el mismo.

¿Cómo se asemejan el teatro francés y el teatro español?Presentan estilos en común incluyendo el drama, el misterio y la moralidad, sin embargo, en el teatro español existe un mayor énfasis en la religión.Elementos como el uso de disfraces, diálogos, el uso de un narrador, entre otros son comunes en ambos teatros.Los temas y propósito de ambos teatros son similares.

Aprenda más sobre teatro en https://brainly.com/question/16540038

#SPJ1

Describe los personajes principales de la novela de el libro el bosque de los arboles muertos.

Answers

Answer:

Explanation: "El bosque de los árboles muertos" es una novela de Ana Alcolea que cuenta la historia de una adolescente española llamada Beatriz, quien viaja a Escocia para mejorar su inglés y se aloja con la familia McAllister en un castillo habitado por el decimoctavo conde de Tuleyork, Lord Douglas MacLachlan, cuya esposa Renata murió hace años. Además de Beatriz y Lord Douglas, los personajes principales de la novela incluyen a Catherine, la mujer de la familia McAllister; George, el padre de la familia escocesa; Charles y William, dos hermanos gemelos rubios de 8 años; y Peter, el hijo mayor de los McAllister, quien ayuda a Beatriz en su búsqueda de la verdad sobre la muerte de Renata.

and if you speak english "El bosque de los árboles muertos" is a novel by Ana Alcolea that tells the story of a Spanish teenager named Beatriz, who travels to Scotland to improve her English and stays with the McAllister family in a castle inhabited by the eighteenth Earl of Tuleyork, Lord Douglas MacLachlan, whose wife Renata died years ago. In addition to Beatriz and Lord Douglas, the main characters of the novel include Catherine, the wife of the McAllister family; George, the father of the Scottish family; Charles and William, two eight-year-old blond twins; and Peter, the eldest son of the McAllisters, who helps Beatriz in her search for the truth about Renata's death.

Other Questions
1. If a triangular gate of height 581 mm and base of 854 mm is vertical and submerged in water with its vertex at the liquid surface. Determine the total pressure (kN) acting on the gate.If a triangular gate of height 14 m and base of 8 m is vertical and submerged in oil wherein its vertex is 13 m below the liquid surface. Determine the total pressure (kN) acting on the gate.If a rectangular gate of length 16 m and width of 2 m is vertical and submerged in water wherein the longer length at the liquid surface. Determine the location in meters of the total pressure from the bottom of the gate. A precipitate forms when a solution of lead (i) chloride is mixed with a solution of sod um twdroxide. Write the "formula" cquation describing this chemical reaction. Which of the following structures supports elements with more than one predecessor?a. Stackb. Queuec. None of the other answersd. Binary Tree Our perception of the color of an object is determined by both the color of the object and the color of the light striking it. True False Question 43 (1 point) Saved What is responsible for the most deaths in building fires? O burns heat stroke smoke inhalation. Find the following Laplace transforms (a) L[(1e t)/t] (b) L[sinh 2t/t] (c) L[(coshtcost)/t] (d) L[sinh 2t/t 2] 2. Calculate (a)L[ 0t1e d], (b) L[t 0tsind] Write an Xcode to view the UI feature. (Use your own example)What is a hobbyist attack? help please. its worth 20 percent of my gradeeee!!! A firm with a return on common equity (ROCE) of 30% has financial leverage of 37.5% and a net after-tax borrowing cost of 5% on $240 million of net debt.i) What rate of return does this firm earn on its operations?ii) The firm is considering repurchasing $150 million of its stock and financing the repurchase with further borrowing at a 5% after-tax borrowing cost. What effect will this transaction have on the firms return on common equity if the same level of operating profitability is maintained?iii) Will this repurchase change the per-share intrinsic value of the equity? Why?iv) Will the normal P/E ratio for this firm change because of this transaction? Why?v) The firm had an unlevered price-to-book ratio (P/B) of 1.8 prior to the transaction. What will be the effect of the repurchase on the levered price-to-book ratio?vi) Would you expect the earnings-per-share growth rate to change after the repurchase transaction? Why? which best describes why it is so difficult to change the paradigm of health care from disease orientation to promoting health orientation? Larry Matt completed these transactions during December of the current year: Dec. Began a financial services practice by investing $15,000 cash and office 1 equipment having a $5,000 value. Purchased $1,200 of office equipment on credit. Purchased $300 of office supplies on credit. Completed work for a client and immediately received a payment of $900 cash. Completed work for Precept Paper Co. on credit, $1,700. Paid for the supplies purchased on credit on December 3. Paid for the annual $960 premium on an 2 3 4 8 10 14 Paid for the annual $960 premium on an insurance policy. 18 Received payment in full from Precept Paper Co. for the work completed on December 8. 27 Larry withdrew $650 cash from the practice to pay personal expenses. 30 Paid $175 cash for the December utility bills. 30 Received $2,000 from a client for financial services to be rendered next year. Prepare general journal entries to record these transactions. Explanations are Required. SCENARIO You are a recent graduate from one of the international universities. You have been approved to work at one of the well-known and famous organizations with this certificate. Your boss called you to his office on your first day of work to inform you of a task you must do. You were informed and ordered to create a project. The project aims to obtain a sum of money to be handed to the organization as a new employee. A payment of MYR 5 million every month for a year is required. You also need to pay the first payment after three months from the start of the project. The organization only cares about the money, not the means of creating it. Hence, all project planning is dependent on your creativity and critical thinking. QUESTION As an employee, explain your plan and the actions you will take to achieve that objective. You also must consider the probability of not being caught if your planning involves an abuse of the law. 1.CRIME THAT CAN BE DONE2.HOW TO DO THE CRIME?3.HOW TO DISTRIBUTE THE MONEY?4.STEPS THAT CAN BE TAKEN SO THAT THE COMPANY WON'T GET CAUGHT A project will result in a $25,000 increase in accountsreceivable and require a decrease in inventory levels by $10,000 to$95,000. What is the net cash flow for capital budgetingpurposes? Complete the following program that finds the sum and average of the numbers from 4 until a user specified number using a while loop. #include using namespace std; int main() { cout identify 3 different asset classes demonstrate an understanding of the risk/reward relationship for each of the asset classes know when it is appropriate to invest in each of the asset classes given each class's riskiness what risk are rating agencies grading for bond ratings what is an advantage of holding municipal bonds? What determines whether this is an advantage for the individual investor? What does the acronym TIPS stand for? What are TIPS used for? What is a zero-coupon bond? Why do investors generally hold bonds in a portfolio? Why do investors generally hold stocks in a portfolio? What is market capitalization? What does PE signify about a company? Consider the curve C that traces out the rectangle in the xy-plane with vertices (0,0), (-2,0), (-2,-3), and (0, -3) in that order (counter-clockwise). Use Green's theorem to compute the Integral of 5. A heterogenous catalyst was evaluated in the oxidation of methanol at 300 C The catalyst surface normalized rate was found to be 5.1 mmol/(s.m 2) The active site density of the catalyst was found 1.6 mmol/m 2Calculate the TOF of the catalyst in these conditions Which of the following is true regarding detectives/investigators?1.They are civilian employees of a police agency, without the power of arrest.2.Higher ranking police officers with more experience than patrol officers3.Their full-time job is to collect and analyze evidence4.All of the above are true Composition Imagine you had gone to sleep. When you woke up in the morning, you were either Spiderman, Superman or Batman. Write an account based on the following: What did you do in this situation? What was the reaction of your family members? Write about all your adventures. How did you feel when you woke up? Remember to write in paragraphs. (word limit 150-175) A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT You are interested in studying the perceived effectiveness of a new drug being used in the treatment of Alzheimer's disease. Given this intent of this study, apply the following: population, sample, parameter, and statistic.