3. Write the complimentary sequence of DNA for the following strand:
5'-AATTAGGAGCCCAGCTTTGCCGA-3'

Answers

Answer 1
The correct answer is TTAATCCTCGGGTCGAAACGGCT

This is because whenever you’re trying to find the complementary sequence of DNA, you basically switch which the listed base and it’s correspondent.

Adenine -> Thymine
Cytosine -> Guanine

Hope this helps!! :)

Related Questions

2. List the THREE inorganic chemical substances commonly found in the human body.
It’s for anatomy and phis

Answers

Answer:

water, carbon dioxide, and acids

Explanation:

if that's not what u need comment

need help ASAP due in 5 minutes

Answers

Placement of legend is the correct answer.

Fill in the Blank Question
Organisms can be classified as __________ or _________
based on how they obtain their energy in an ecosystem.

Answers

Answer: Autotrophs , Heterotrophs

Explanation:

When scientists make predictions are they always right? If they are not what happens?

Answers

Answer:

NO.

Explanation:

They are not always right because when it seems like it is right, it would suddenly make a different direction.

Help me plzz i need help with this I think one of them is sweating I am not sure though

Answers

Answer:

I am almost certain it's A and B.

:0)

Imagine animal cells had chloroplasts. Chloroplasts allow plant cells to perform photosynthesis. How do
you think this would change the way animals gain energy?

Answers

Answer:

It would change the way they gain energy by the animals not having enough things in the body to get it functioning right.

Explanation:

think of it as gas our cars need gas to run, so do animals and us but our gas is food

If animal cells had chloroplasts, it means animals would be able to gain energy directly from sunlight by being able to manufacture carbohydrates as a food source.

The presence of chloroplast would allow an animal cell to photosynthesize and manufacture foods in the form of carbohydrates.

[tex]6CO_2 + 6H_2O ---> C_6H_1_2O_6 + 6O_2[/tex]

The food can be broken down during respiration in order for the energy to be extracted.

[tex]C_6H_1_2O_6 + 6O_2 ---> 6CO_2 + 6H_2O[/tex]

This would be in addition to animals' ability to gain energy from external food sources through the same respiration.

More on photosynthesis can be found here: https://brainly.com/question/1388366

n the 1600's, Robert Hooke, and English scientist, used a crude microscope to examine bits of cork. Cork is derived from the bark layer of certain trees. Upon seeing the cork under the microscope, Hooke named the spaces within the cork 'cells', because they looked like empty rooms of a monastery. Although he coined the term cell, an ironic feature of cork is that it is dead plant material. Knowing this, what feature of cells would Robert Hooke NOT have been able to observe under the microscope while looking at cork?

Answers

Answer:

the answer is C: he would not be able observe cork cells dividing to form new cells

Explanation: i just got it wrong from the other guy

Answer:

The correct answer is C.

Explanation:

When you observe something through a telescope, you manage to see what it is made. Therefore, when you see what it is made of, you can rule out some answers. C is the right answer because cells are the smallest living thing,and cannot be seen unless using an extremely powerful microscope.

The data in the table has been converted into a bar graph, as shown below. Amount of Carbohydrates in Fruit A 2-column table with 7 rows. Column 1 is labeled 237 Milliliters of Fruit with entries Apples, Bananas, Cherries, Grapefruits, Oranges, Peaches, Watermelons. Column 2 is labeled Carbohydrates (Grams) with entries 17, 34, 19, 24, 21, 16, 12. A graph titled Grams of Carbohydrates in 237 Milliliters of Fruit shows fruit on the x acid and Carbohydrates in grams on the y axis. There are 17 Apples, 34 Bananas, 19 Cherries, 24 Grapefruits, 21 Oranges, 16 Peaches, 12 Watermelons. Which reason provides the best explanation of why a bar graph was selected to show the data in the table? Bar graphs are used to compare separate items. Bar graphs are used when data are continuous. Bar graphs are often used to show mass. Bar graphs are the easiest to construct and to read.

Answers

Answer:

Bar graphs are used to compare separate items.

Explanation:

A bar graph is used because it helps to compare items. So the correct option is A.

What are bar graphs?

Bar graphs are a kind of pictorial representation of data which is generally in grouped form. It can present the data in the form of both vertical and horizontal rectangular bars.

In this graph, the length of the bars is used as proportionate to the value of data. These graphs are also called bar charts. Bar graphs are one of the various methods of data handling in the field of statistics.

Statistics is defined as the collection, presentation, organisation, analysis, and interpretation of data observations. In statistics, there are various other methods of data representation. These are tables, bar graphs, pie charts, histograms, frequency polygons, etc.

A bar graph is one of the several methods of data representation and is used for comparing the values of items in the data.

Therefore the correct option is A.

Read more about bar graphs, here

https://brainly.com/question/8644324

#SPJ6

A softball is hit high into the air. As it rises, the softball


A) loses kinetic energy and loses potential energy.

B) loses kinetic energy and gains potential energy.

C) gains kinetic energy and gains potential energy.

D) gains kinetic energy and loses potential energy.

plz help

Answers

Answer:

B

Explanation:

hoped I helped

If a beaker contains 0.32L of water. What is the volume of the water in milliliters?

Answers

Answer:

320000 cubic millimeters!

Explanation:

I hope this helps. :))

In the morning, the water levels in a local marsh rise and cover the clam beds. In the evening the water level decreases, making it easier for local fisherman to collect clams. What type of disruptive event does this describe?

Episodic
Extinctive
Periodic
Random

Answers

Answer:

Periodic

Explanation:

got the question right

Disruptive events are disasters that disturb the pre-determined arrangement. The change in the water level in the local marsh is an example of periodic disruptions. Thus, option C is correct.

What are periodic disruptions?

Periodic disruptions are the disturbances in that occur in a regular time interval at a fixed rate and fix time. The episodic are occasional and irregular events, while the random is not determined and fixed at all.

The water level shows the period movement as it decreases in the evening and rises in the morning. It shows that the water level rises and decreases in a regular pattern and time.

Therefore, the rise and decrease in water level is a periodic disruptive event.

Learn more about disruptive events, here:

https://brainly.com/question/7414936

#SPJ2

Biology Semester 2
What happens during interphase?

Answers

During interphase, the cell grows and the nuclear DNA is duplicated. Interphase is followed by the mitotic phase. During the mitotic phase, the duplicated chromosomes are segregated and distributed into daughter nuclei.

We interact with solids, liquids, and gases on a daily basis.
Can you think of some examples of when we need these three states of matter for our survival? List one of each
state and the rationale, or reason, for why each is necessary.

Answers

Answer: water, oxygen, and food

Explanation:

Please help me anything helps.

Answers

Answer:

An earthquake

Explanation:

An earthquake is caused when plates move around and clash.

When two tectonic plates grind against each other they cause an earthquake.

Specific ways that humans have caused some species to go extinct

Answers

Answer:

Destruction of animals' habitats. Some examples of this are... tree logging, slash and burn farming, and deforestation. Humans also hunt animals to extinction either for sport or food.

Explanation:

Which Punnett square represents a cross between two parents that are heterozygous for purple flowers? ​

Answers

Answer:

The allies for the purple color of the flowers of pea

Explanation:

Punnett square is a square diagram which is used to predict the genotype of the offspring produced by particular cross.

Let P and p be the alleles of the gene responsible for the flower colors in a plant.

The genotype of both the parents is given as heterozygous that is, Pp.

Two types of gametes would be formed P and p.

Which element matters least in the process of natural selection?

Answers

Given question is incomplete as it lacks the group of choices. However, the group of choices associated with the question is as follows:

1. Organisms must display variation.

2. A trait must increase reproduction.

3. A trait must directly affect metabolism.

4. A trait must increase survival.

5. A trait must be able to be passed on to future generations.

Answer:

The correct answer is : option 3. A trait must directly affect metabolism.

Explanation:

The process that leads to change or adaption in the species or a population of the organism known as natural selection. In this process population exhibits the variation in the population due to the change or adaption.

This variation refers to the better traits and increased reproductive ability, suited to the environment than others which is also known as survival of the fittest as they increase their survival in comparison to the other population or species. Natural selection carries traits that are passed on to one generation to another.

Thus, the correct answer is option Is : 3. A trait must directly affect metabolism.

What is the substance that regulates life’s processes?

Answers

Answer:

Heyo!

Explanation:

At all levels of the organizational scheme, there is a division of labor. Each component has its own job to perform in cooperation with others. Even a single cell, if it loses its integrity or organization, will die.

Um Hope This Helps? ._.

Where is most of earth fresh water found

Answers

Over 68 percent of fresh water on Earth is found in icecaps and glaciers, and just over 30 percent is found in ground water. Only about 0.3 percent of our fresh water is found in the surface water of lakes, rivers and swamps.

Source: Google

Answer:icecaps and glaciers

Explanation:

I. Match the following.

1. a minus-charged particle of an atom
2. a neutral (no charge) particle found in the nucleus of an atom
3. a positive-charged particle in the nucleus of an atom
4. a system of comparing atomic masses to carbon

a. proton
b. relative mass
c. electron
d. neutron


II. The atomic number of an atom is equal to the number of _____

a. neutrons
b. electrons
c. protons


III. The atomic number is always equal to the atomic mass.

True
False


IV. Atomic mass minus atomic number =

atomic mass
number of electrons
number of neutrons
number of protons


V. A proton in the nucleus of an atom has an electrical charge of:

neutral
-
+
zero


VI. The atomic number of calcium is 20. This number means that calcium has 20 protons. The atomic mass of calcium is 40. How many neutrons does calcium have? (Remember: protons + neutrons = atomic mass.)

a. 40
b. 60
c. 20


VII. Helium has an atomic number of 2. This number also means that helium has 2 protons. The atomic mass of helium is 4. How many neutrons does helium have? (Remember: protons + neutrons = atomic mass.)

a. 2
b. 4
c. 6


VIII. The relative atomic mass of a proton or neutron is ____

a. 1
b. 2


IX. The relative atomic mass is always a mass that is compared to the element

a. carbon
b. oxygen
c. hydrogen


X. Name the three kinds of sub-atomic particles found in an atom:

a. Protons
b. Electrons
c. Neutrons
d. Polyhedrons
e. Axons

Answers

I.

1. a minus-charged particle of an atom..... Electrons

2. a neutral (no charge) particle found in the nucleus of an atom..... Neutrons

3. a positive-charged particle in the nucleus of an atom.... Protons

4. a system of comparing atomic masses to carbon.... Relative mass

II. The atomic number of an atom is equal to the number of Protons.

III. The atomic number is always equal to the atomic mass. False.

IV. Atomic mass minus atomic number =number if neutrons.

V. A proton in the nucleus of an atom has an electrical charge of: +ve (positive).

VI. The atomic number of calcium is 20. This number means that calcium has 20 protons. The atomic mass of calcium is 40. How many neutrons does calcium have?

Answer: No of neutrons = atomic mass-atomic number

No of neutrons= 40-20=20 neutrons.

VII. Helium has an atomic number of 2. This number also means that helium has 2 protons. The atomic mass of helium is 4. How many neutrons does helium have?

Answer: No of neutrons = atomic mass-atomic number

No of neutrons= 4-2=2 neutrons.

VIII. The relative atomic mass of a proton or neutron is 1.

IX. The relative atomic mass is always a mass that is compared to the element Corbon.

X. Name the three kinds of sub-atomic particles found in an atom: electron, proton and neutron

Part D Do you think the gene EEF1 ALPHA1 supports cell theory? Explain your response.

Answers

Answer:

I don't understand your question, give further explanation please.

I will give brainliest!!!!!!! Protein synthesis can occur on the rough endoplasmic reticulum (ER) but not on the smooth ER. Which cell structures are attached to the surface of the rough ER that allow it to make proteins? Choose 1 answer: A DNA strands (Choice B) B Vacuoles (Choice C) C Chloroplasts (Choice D) D Ribosomes

Answers

Answer:

D. Ribosomes

Explanation:

Rough endoplasmic reticulum (RER) bears ribosomes on it surface which give it granular apperance and they are the site of protein synthesis.

Answer

The answer is a

how long will take an object traveling at 25 m/s to reach a distance of 125 meters? ​

Answers

Answer:

5 sec

Explanation:

125m

25 m/s

= 5 sec

It will take 5 seconds for an object traveling at 25 m/s to reach a distance of 125 meters.

Speed = distance / time

Time = distance / speed

Distance = 125m

Speed = 25 m/s

Time = 125 / 25 s

Time = 5 s

What's the connection between pace and distance?

The rate is the time fee of exchange of the distance. If 'D' is the distance of an item in some time 'T', the rate is the same too, s = D/T. It has equal devices as speed.

Velocity, being a scalar amount, is the fee at which an object covers distance. The average speed is the distance (a scalar amount) according to the time ratio.

Learn more about the speed and distance here https://brainly.com/question/4931057

#SPJ2

In the food chain of "algae-------> mosquito larvae --------> frogs -------> racoons," algae are the Consumers Heterotrophs Detrivores Autotrophs

Answers

Answer:

Autotrophs

Explanation:

Food chain is a step by step feeding process in an ecosystem where an organism producer is been feed on by another organism that depends on it

called consumer and it is also feed on by predator. Producer usually produce their food its includes plants, Algae, phytoplankton.

The energy level moved from the producer to the last organism on the chain.

Autotrophs are the same as producer and an Algae food chain is an example of aquatic food chain where algae serves as primary source of energy(Producer) and its been feed upon by mosquito larvea and larvea by frogs and frogs are eaten by racoon.

What is the basic Sl unit of mass?

Answers

Answer:The SI unit of mass is the kilogram

Explanation:

Answer:

Kilogram (Kg)

Explanation:

Scientists predict that we will eventually use up all available fossil fuels. Which list includes only fossil fuels?
O wood, natural gas, and coal
O natural gas, coal, and oil
O wood, natural gas, and solar
O coal, oil, and solar

Answers

Scientists predict that we will eventually use up all available fossil fuels natural gas, coal, and oil includes only fossil fuels.

What are the 4 types of fossil fuels?

Fossil fuels contain coal, petroleum, natural gas, etc.

All have carbon and were formed as a consequences of geologic function working on the remains of organic matter generated by photosynthesis

Thus, option "B" is correct, natural gas, coal, and oil.

To learn more about fossil fuels click here:

https://brainly.com/question/2582135

#SPJ2

Answer:

natural gas, coal, and oil

in which layer is lithification most likely to occur?

Answers

The layer that most likely to occur is layer 1

Answer: They are right it is answer #1 because it is the most compact part of the rock/rocks for lithification.

All living cells must maintain homeostasis or internal stable conditions in order to survive. Which of the following processes would best help a cell to maintain these conditions
(SC.6.1.142)
АО
using energy
BO
creating DNA
using carbon dioxide
creating water molecules

Answers

Answer:

None of the options provided is correct but some are close

Explanation:

One of the ways in which a cell maintain homeostasis is by regulating what goes in and out of the cell through the cell membrane (which is a semi-permeable barrier). The amount of water is highly regulated by the cell in this case so as to regulate osmosis (movement of water molecules from a region of higher concentration to a region of lower concentration). Other substances regulated are oxygen and carbon dioxide.

NOTE: The cell does not create water molecules neither does it use carbon dioxide to maintain homeostasis, it rather regulates these two compounds.

What increases the number of tissues in an embryo?

Answers

An embryo is a early stage of development of a multicellular organism

Which component makes each amino acid unique?
amino group
carboxyl group
R group
O phosphate group

Answers

Answer:

R group

Explanation:

An organic R group (or side chain) that is unique to each amino acid.

Answer:

r group

Explanation:

i took the test

Other Questions
whats the value of -9(8.15) Prompt: Is it beneficial to express your personal views on civil right disputes? CAN SOMEONE HELP ME WRITE A INTRODUCTION FOR MY ARGUMENTATIVE ESSAY PLEASEEE! The Latin verb, intagliare, meaning,a. to cut intob. to pastec. to combine The green turtle, Monique, traveled 250 centimeters in 8.7 minutes. A total of 2n cards, of which 2 are aces, are to be randomly divided among two players, with each player receiving n cards. Each player is then to declare, in sequence, whether he or she has received any aces. What is the conditional probability that the second player has no aces, given that the first player declares in the affirmative, when (a) n = 2? (b) n = 10? (c) n = 100? Which of the following does the First Amendment not protect? A. Racist or xenophobic speech. B. Sexist or homophobic speech. C. Political or partisan speech. D. Threatening speech. what the disadvantages of integrated of farming? 8c = 56two step equation why does the reactivity of elements increase going down Group 1 from lithium to rubidium but decreases going down Group 7 from fluorine to iodine? solve x-5/y = z for y Which statements accurately describe volume? Check all that apply. Explain why lack of charity seen in young people today 2. Boston became the most prominent shipping center in the triangular trade.TrueFalse Help me The digit 1 in witch number represents a value of 1 tenth? A.2.916B.718C.5108 Write the ratio as a fraction in simplest form, with whole numbers in the numerator and denominator24 min to 64 min 66.7 - 6 x 14 + 99 x -6 = ? Answer, Please & Thanks ! The media is a powerful influence because it A.Encourages teens to live healthy livesB.is constantly presentC. Provides healthy role models.D.warns the audience of risk behaviors the perimeter of a rectangle is 48. The length is 2x and the width is twice the length. Find the length and the width. Please answer!!! DO even single celled organism maintain homeostasis?