A political effect of the Lewis and Clark Expedition was the​

Answers

Answer 1

Answer:

The Lewis and Clark Expedition provided valuable scientific and geographic knowledge of the West.

Explanation:


Related Questions

Which os the following is true of the system of slavery emplayed by the Portugese in Brazil

Answers

The system of slavery employed by the Portuguese in Brazil instituted a) Commodity slavery that was harsher, intercontinental, and e) Descent–based slavery (hereditary).

What was slavery like in Brazil?

Before the Portuguese introduced transatlantic slavery in Brazil, there was forced labor of Natives and debt bondage as slavery forms.

However, when the Portuguese extended slavery to West Africa based on the growing demand from Spanish and English plantations, the trading of enslaved people grew, and the enslaved people became commodities.

As commodities, they were not treated well. They also passed on their social and economic status to their descendants, making them perpetual enslaved persons.

Thus, the true statements about the system of slavery employed by the Portuguese in Brazil included Options A and E.

Learn more about the Portuguese and slavery at https://brainly.com/question/790586

#SPJ1

Question Completion with Answer Options:

a) Commodity slavery

b) Limited slavery

c) Forced labor

d) Debt bondage

e) Descent–based slavery

In contextualizing the Civil War, Lincoln urges listeners to recall the principles upon which
the United States was founded. In the context of this article, how has America changed over
time? Use the speech, your own experience, and other literature, art, or history to develop
and support your answer.

Answers

To dedicate a plot of land that would become Soldier's National Cemetery.

What is Lincoln's main purpose in making this speech?

At the time it was delivered, the Gettysburg Address' major goal was to honour a brand-new national cemetery in Gettysburg. Additionally, it clarified Lincoln's motivation for fighting on to end the Civil War: the abolition of slavery and the union's reunification.

What was Lincoln's purpose in writing the Gettysburg Address paragraph?

Lincoln's address was given with the intention of dedicating the land that would become Soldier's National Cemetery. Lincoln understood, nevertheless, that he also needed to motivate the populace to carry on the struggle. Below is the text of the Gettysburg Address, with my observations about what made it so memorable interwoven.

To know more about Civil War visit:

https://brainly.com/question/28247761

#SPJ1

If an important resource, such as oil, becomes unavailable, the production possibilities curve
a. shift inwards
b. shift outwards
c. shift to the right
d. not shift

Answers

If an important resource, such as oil, becomes unavailable, the production possibilities curve shift to the right. If the determinant raises demand, the curve moves to the right. This shows that there is a higher demand for the good or service even when the price is the same.

The incomes of consumers will increase as the economy is flourishing. When demand is steady and supply is increasing, the supply curve moves to the right, creating an intersection where quantity and prices are lower. On the other hand, a negative change in supply causes the curve to move to the left, raising prices and lowering quantity.

To learn more about curve, click here.

https://brainly.com/question/15229417

#SPJ1

Which of the following developments marked the transition from prehistory to the
historical age? (meaning: What was the first writing?)
•cuneiform
• Phoenician alphabet •Hammurabi's Code
•the Torah

Answers

Answer:

cuneiform

(∩˃o˂∩)♡

U.s. attacked; hijacked jets destroy twin towers. Why did police ask people to leave the area

Answers

Answer: Police asked people to leave the area because there was a heavy amount of smoke due to the building crashing down. They wanted everyone to evacuate or stay in a 1 story-high building so people wouldn't get seriously injured.

Explanation: Hope I helped!

Which of the following sentences correctly uses the word sovereign?
Under English rule, each of the 13 colonies was a sovereign
country.
OTexas is a sovereign state.
The two branches of the U.S. legislature are the Senate and the
Sovereign.
None of these choices are correct.
The creators of the Declaration of Independence wanted to create
a new, sovereign nation.

Answers

The sentences that correctly uses the word sovereign is that None of these choices are correct.

What is the meaning of a sovereign state?

State sovereignty is known to be a term that connote  the legal authority as well as the responsibility of a specific independent state in its role to rule and regulate its political affairs without any form of foreign interference.

Note that Sovereign states are those who supreme authority every aspect of their territory and when you look at the options, they are all wrong.

Thus, The sentences that correctly uses the word sovereign is that None of these choices are correct.

Learn more about sovereign from

https://brainly.com/question/1496479

#SPJ1

During the American Revolution, women:
A. Served as military officers
B. Sometimes took over farms when their husbands were off fighting
C. Failed to make sacrifices
D. Never became battlefield nurses

Answers

Explanation:

Women supported the American Revolution by making homespun cloth, working to produce goods and services to help the army, and even serving as spies.

this river valley civilization was the first to say a circle is 360° and that an hour is 60 minutes

a.mesopotamia
b.ancient egypt
c.indus river valley
d.ancient greece.

Answers

The answer is A. Mesopotamia

what is another way to say Any government that separates powers among different branches needs a system of checks and balances. In such a system, each branch has some power to check—to restrain or stop—actions by the other branches. This means that each branch can change or overturn some actions of the others.

Answers

In such a system of check and balance, each branch has some power to check (restrain or stop) the actions by the other branches, so, this means that each branch can change or overturn some actions of the others.

What is check and balance?

The system of checks and balances is one of the constitution doctrines that is used to keep each branch of government from getting too powerful in one branch. For example, the example of check and balance is observed as the Executive Branch can veto bills from the Legislative Branch but the Legislative Branch can override the veto.

Read more about check and balance

brainly.com/question/13220662

#SPJ1

Which of the following techniques did Mussolini NOT use to maintain power?

Question 5 options:

Secret Police


Violence


Militarize Society


Open and free elections

Answers

Secret police is the answer

How do church help promoting reform unit 1 review

Answers

Answer:

The Reformation became the basis for the founding of Protestantism, one of the three major branches of Christianity. The Reformation led to the reformulation of certain basic tenets of Christian belief and resulted in the division of Western Christendom between Roman Catholicism and the new Protestant traditions.

Explanation:

what is an example of an american dynasty

Answers

Answer:

The Rockefellers: An American Dynasty.

Answer:

Bush Dynasty

Explanation:

What is an example of American dynasty?

1: Bush Dynasty

Before the Bush men were governors and presidents. Americans may not romanticize the Bush family in the same legendary manner ascribed to the Kennedys, but they arguably are the most successful political dynasty of the 20th century.

Quick write: death of the queen
+8 lines

Answers

Some useful tips to help you write about the death of Queen Elizabeth are:

Mention the birth date of the queenList out her notable achievementsState what her reign as a monarch was like.List her most distinctive featuresDescribe the atmosphere on world politics following her passingWrite expressivelyConclude

This is important as it would help you write out the important details of Queen Elizabeth and it would also enable your readers to have a feel of what type of person she was.

What is a Narration?

This refers to the storytelling done with the help of a narrator to show sequence of events.

Hence, we can see that Some useful tips to help you write about the death of Queen Elizabeth are:

Mention the birth date of the queenList out her notable achievementsState what her reign as a monarch was like.List her most distinctive featuresDescribe the atmosphere on world politics following her passingWrite expressivelyConclude

This is important as it would help you write out the important details of Queen Elizabeth and it would also enable your readers to have a feel of what type of person she was.

Read more about narrations here:

https://brainly.com/question/1934766

#SPJ1

I NEED AN ANSWER BY 11:30 PM
How do the advantages and disadvantages of feudalism and manorialism influence political, religious, economic, and social changes in medieval civilizations? (at least 4 sentences)

Answers

Generally, the advantages and disadvantages of feudalism and manorialism influence political, religious, economic, and social changes in medieval civilization because the system created a ordered society because of need of protection.

What is feudalism?

This form of government referred to the dominant social system during medieval Europe in which the nobility held lands from the Crown in exchange for military service in turn tenants of the nobles while the peasants were obliged to live on their lord's land and give him homage, labour and share of the produce in exchange for military protection.

What is manorialism?

It refers to the political, economic, and social system by which the peasants of medieval Europe were rendered dependent on their land and on their lord..

Read more about feudalism

brainly.com/question/4141227

#SPJ1

Which ideal presented in the preamble is most related to Marcus’s concern?

Read the scenario.

Marcus, who is in ninth grade, has read statistics about how often police officers stop Black people for minor traffic violations as compared to White people. Next week, a representative from the local police force is coming to speak at an assembly at Marcus’s school. Marcus is eager to raise this issue with the officer. He would like to be a police officer one day, but first he wants to do whatever he can to make sure everyone is treated equally.


“We the People”
“establish Justice”
“to form a more perfect Union”
“provide for the common defence”

Answers

Answer:

"establish justice"

Explanation:

Marcus wants to make sure that there are equal rights for everybody. Establishing justice means that the government treats everybody fairly which is the concern that Marcus wants to bring up.

What is the commerce clause? How has it affected congressional power?

Answers

Answer:

Explanation:

The Commerce Clause of the U.S. Constitution gives Congress the power to regulate commerce among the states. The line between intrastate and interstate activity has grown increasingly blurry over time. Interpretations of the clause have been controversial, oscillating between broad and narrow views.


How is organizing history by theme different from organizing history by
region?

Answers

Organizing history through theme is different from organizing history with the aid of a regional historian who organizes the past by means of topic research a huge concept that happens across human records, a historian who organizes records with the aid of subject matter studies a selected term, while a historian who organizes records through area research. allow historians to evaluate seemingly unrelated societies based totally on an unmarried vital concept. a historian who organizes records by way of region and makes a specialty of a selected location of the sector.

Organizating or organising is the establishment of effective authority relationships among decided on works, persons, and paintings locations so as for the organization to paintings collectively efficiently, or the manner of dividing work into sections and departments.

Organizing is the control characteristic that follows after planning, it involves the task of responsibilities, the grouping of duties into departments, and the undertaking of authority with good enough obligation and allocation of resources across the company to obtain commonplace desires. Organizing your everyday agenda and tasks permits you to concentrate on what wishes to get carried out that day rather than being distracted by matters around you. at midnight, you're capable of prioritizing sleep and rest without difficulty understanding it's completed. As an introduced bonus, prioritizing sufficient sleep alleviates your pressure.

Learn more about Organizing here:

https://brainly.com/question/25922351

#SPJ9

A historian who organizes history by theme studies a big idea that occurs over an extended length of time, whereas a historian who organizes history by region focuses on a specific area of the world.

Records is the observe and the documentation of the past. Activities earlier than the invention of writing structures are considered prehistory. History is an umbrella term comprising beyond events in addition to the reminiscence, discovery, series, enterprise, presentation, and interpretation of these occasions.

Records is the know-how of and look at of the past. it is the story of the past and a form of collective memory. History is the story of who we're, wherein we come from, and may doubtlessly monitor where we are headed.

Studying records allows us recognize how events inside the past made matters the manner they're these days. With training from the beyond, we no longer simplest study ourselves and how we came to be, but additionally broaden the capability to avoid errors and create better paths for our societies.

Learn more about history here:- https://brainly.com/question/24466312

#SPJ9

Read the following excerpt from the March 31, 1776 letter from Abigail Adams to John Adams.

Answers

“I long to hear that you have declared an independency. And, by the way, in the new code of laws which I suppose it will be necessary for you to make, I desire you would remember the ladies and be more generous and favorable to them than your ancestors.
“Do not put such unlimited power into the hands of the husbands.
“Remember, all men would be tyrants if they could. If particular care and attention is not paid to the ladies, we are determined to foment a rebellion, and will not hold ourselves bound by any laws in which we have no voice or representation.
“That your sex are naturally tyrannical is a truth so thoroughly established as to admit of no dispute; but such of you as wish to be happy willingly give up – the harsh tide of master for the more tender and endearing one of friend.
“Why, then, not put it out of the power of the vicious and the lawless to use us with cruelty and indignity with impunity?
“Men of sense in all ages abhor those customs which treat us only as the (servants) of your sex; regard us then as being placed by Providence under your protection, and in imitation of the Supreme Being make use of that power only for our happiness.”

Hope this helps!

What aspect of the Coercive Acts and Quebec Act did the rebellious colonists use popular protest to dispute?

making judges, sheriffs, and peace officers directly answerable to the royal governor

expanding the boundaries of Quebec

suspending all town meetings

closing Boston Harbor

Answers

Making judges, sheriffs, and peace officers directly answerable to the royal governor

What cant the harrier airplane do?

Answers

Answer:

it cant swim

Explanation:

plane go fly not swim if it tries to swim it dies

How did the society the Pilgrims
developed in Plymouth differ from specific
aspects of English society?

Answers

The Pilgrims were different from the other settlers coming to the "New World," because they were no longer Anglican, and they came for true religious freedom. The Pilgrims were once Puritans, but they felt the Anglican Church had not reformed enough.

The Pilgrims, also known as the Pilgrims Fathers, were British settlers who came to North America on the Mayflower and founded the Plymouth Colony in what is now Plymouth, Massachusetts. Named after the last port of departure from Plymouth. A reformer of the most extreme kind. Although they called themselves saints, they were also known as separatists because they wanted to completely separate themselves from the mainstream church. Following in the footsteps of his five pilgrims in modern times, he follows in the footsteps of his ancestors, spreading kindness and preserving his legacy. There are tourists who want a temporary respite from everyday life and a glimpse of famous landmarks.

Learn more about Pilgrims  here

https://brainly.com/question/1788552

#SPJ1

Take a moment to tell us a little about yourself and why you are taking this course!​

Answers

When asked, "Tell me about yourself," your objective should be to provide a succinct, brief overview of your professional history that will highlight any pertinent experience. You want to begin with a point in time (like when you first started working in this profession) and end with where you are now. Think about your interests. Consider your hobbies.

You can talk about your career aims, goals, and how the course fits in with those when you respond to the question of why you wish to take this course. accentuate your assets, Keep your attention on the good things and be upbeat.

A professional background is your past employment history and professional experience. This is applied during the hiring process.

Learn more about professional history here:

https://brainly.com/question/14865214

#SPJ9

Why did politicians in government begin to act to protect labor rights in the early 1900s?

Answers

after 1900s they wanted people to work safe

The early 1900s saw an increase in labor unrest and the rise of labor unions. Many workers faced long hours, low wages, and dangerous working conditions.

Politicians in government began to act to protect labor rights due to a combination of factors. One of the major factors was progressive movements that sought to address issues such as workplace safety, child labor, and hours of work. Additionally, politicians recognized the growing power of organized labor and sought to mitigate labor unrest through legislative action.

They also recognized the need to maintain a stable workforce to avoid disruptions to the economy. Over time, the implementation of labor protections helped to improve working conditions, raise wages, and reduce inequality, paving the way for better working standards that benefit all workers.

Learn more about labor rights in 1900 here:

https://brainly.com/question/22817710

#SPJ2

Which Enlightenment philosopher was English and a key thinker of the time period who believed in "natural rights"
and the innate goodness of humanity?
A. Diderot
B. John Locke
C. Niccolo Machiavelli
D. Baron de Montesquieu

Answers

Answer: B Locke

Explanation: he believed in natural rights

Section 3: The Senate
1. Each state will be represented by
2. Term of office for senators is
3. Qualifications for Senators
a.
b.
4. The President of the Senate is
5. The Senate will have the sole power to
Section 4: Elections
Section 5: Rules
years.
1. A quorum is
senators, chosen by
1. Times, places and manner of holding elections will be determined by
Glik
who votes in the case of a

Answers

What authority does the Congress have under Article 4 Section 3 Clause 1?

Nothing in this Constitution shall be interpreted in a way that would impair the claims of the United States or of any particular State. The Congress shall have the authority to dispose of and make all necessary rules and regulations regarding the Territory or other property belonging to the United States.

What does Article 1 of the Constitution's Section 3 mean?

Senator Clause 1 in Section 3 Composition. Two senators from each state, appointed for six years by the state legislatures, will make up the US Senate. Each senator will have one vote.

What does the Constitution's Article 1 Section 3 Clause 2 mean?

Seats in Clause 2

They will be divided into three Classes as equally as possible as soon as they are gathered as a result of the first Election.

To Know more about Constitution

https://brainly.com/question/19411179

#SPJ9

PLS HELP I WILL MARK BRAINLIEST
"Why is it important to never forget the events of September 11, 2001?"
reason why is it is important to never forget the events 9/11

Answers

Explanation:

Americans watched in horror as the terrorist attacks of Sept. 11, 2001, left nearly 3,000 people dead in New York City, Washington, D.C., and Shanksville, Pennsylvania. Nearly 20 years later, they watched in sorrow as the nation’s military mission in Afghanistan – which began less than a month after 9/11 – came to a bloody and chaotic conclusion.

The enduring power of the Sept. 11 attacks is clear: An overwhelming share of Americans who are old enough to recall the day remember where they were and what they were doing when they heard the news. Yet an ever-growing number of Americans have no personal memory of that day, either because they were too young or not yet born.

A review of U.S. public opinion in the two decades since 9/11 reveals how a badly shaken nation came together, briefly, in a spirit of sadness and patriotism; how the public initially rallied behind the wars in Afghanistan and Iraq, though support waned over time; and how Americans viewed the threat of terrorism at home and the steps the government took to combat it.

As the country comes to grips with the tumultuous exit of U.S. military forces from Afghanistan, the departure has raised long-term questions about U.S. foreign policy and America’s place in the world. Yet the public’s initial judgments on that mission are clear: A majority endorses the decision to withdraw from Afghanistan, even as it criticizes the Biden administration’s handling of the situation. And after a war that cost thousands of lives – including more than 2,000 American service members – and trillions of dollars in military spending, a new Pew Research Center survey finds that 69% of U.S. adults say the United States has mostly failed to achieve its goals in Afghanistan.

Historians use charts and graphs because these types of resources _____.

Select the best answer from the choices provided.
A.
allow them to easily understand information
B.
show the climate and weather of a region
C.
show a region’s population and location
D.
help them remember things more easily

Answers

Answer:

A

Explanation:

Charts and graphs are a good way to place information all in one place.

I’m pretty sure it’s A

What is the primary purpose of the Declaration of Independence in the United States today?
a. It is a historical document that clearly lays out the strategic support the Americans would need from their allies to secure independence.
b. It is a venerated text that expresses the nation's founding ideals.
c. It lays out the basic structure of the U.S. military organization.
d. It is the fundamental building block of the U.S. legal system.

Answers

Answer: a. It is a historical document that clearly lays out the strategic support the Americans would need from their allies to secure independence.

b. It is a venerate a text that expresses the nation’s founding ideals.

Question 3 of 10 Which statement is true about the Arapaho, Blackfoot, and Cheyenne peoples? A. They were nomadic and followed the animals that they hunted. B. They made an alliance with the peoples of the Tsêhéstáno. C. They settled with various other groups of Indigenous peoples. O D. They traded different parts of the bison for corn, squash, and beans. SUBMIT It's A​

Answers

We can actually deduce here that the statement that is true about the Arapaho, Blackfoot, and Cheyenne peoples is: A. They were nomadic and followed the animals that they hunted.

Who are the Cheyenne and Arapaho Tribes?

The Cheyenne and Arapaho tribes were known to be united and recognized by Western Oklahoma. These tribes were known to be two distinct tribes with distinct histories.

The Cheyennes were known to be agrarian. They were known to be nomadic just like Arapaho who became nomadic equestrians. They depended on their buffalo hunting which they used to sustenance.

Learn more about Cheyenne and Arapaho on https://brainly.com/question/28433009

#SPJ1

The main reason behind the English Reformation was...

a
The Pope refused to annul King Henry VIII's marriage to Catherine of Aragon.
b
The Archbishop of Canterbury, Thomas Cranmer, rejected the pope's decision and ruled that the king's marriage to Catherine was null and void.
c
King Henry VIII was disillusioned with the teachings of the Church.
d
King Henry VIII and the nobility were supporters of Martin Luther's teachings.

Answers

The main reason behind the English Reformation was that the Pope refused to annul/void King Henry VIII's marriage to Catherine of Aragon.

What is English reformation?

The English Reformation took place in the 16th century in England when the Church of England in Great Britain broke away from the authority of the pope and the Catholic Church.

King Henry had asked Pope Clement VII of England for his marriage to Catherine to be dissolved, but the Pope disagreed. Part of the reason that the Pope did not agree was that Charles V, the Holy Roman King, had taken control of Rome-and Charles V was Catherine's nephew.

Therefore, the main reason behind the English Reformation was that the Pope had not agreed to annul/void King Henry VIII's marriage to Catherine of Aragon.

Learn more about English Reformation here:

https://brainly.com/question/2327571

#SPJ1

Other Questions
Juan's professor lectures on the fact that certain features in animals have been passed down from one generation to another. what theory is juan's professor probably describing? If you have three junit test methods written in the same testing class and the first one fails its assertions, will he other methods still be executed? A bakery is making whole-wheat bread and apple bran muffins. for each batch of break they make $35 profit. for each batch of muffins, they make $10 profit. the break takes 4 hours to prepare and 1 hour to back. the muffins take 0.5 hours to prepare and 0.5 hours to bake. the maximum preparation time available is 16 hours. the maximum bake time available is 10 hours. let x = Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA In civil rights literature, which ideology was often at odds with multiculturalism? A. Disillusionment B. Symbolism C. Disenfranchisement D. Black Power Based on what you know of the peptide bonds that link together amino acid residues, why would proline's side chain reduce the flexibility of the backbone? What are "affiliates" asKing uses the word?Consider the context of how the word is used multiple times in paragraph 2. The frequency of a microwave signal is 9.76 ghz. what is its wavelength in meters? help me asap im in a dba back to basics exam and didnt study Imagine that an employer purchases a health insurance plan that costs $365 per month, but requires that the employee pay $35 per month toward the cost of the plan. If the employee's salary is What is the slope of the line that passes through the points (6,2) and (-18,2) If you had to choose one scene from Equianos story to turn into a visual illustration in order to capture his narrative, which one would it be and why? A 78-year-old man is admitted to the emergency department (ed) with bradycardia resulting from overdose of donepezil. the nurse knows that the ed is likely to order which medication? If you see a 1st quarter moon today, what will people on the other side of the earth see later today? What elected group's laws and regulations make laboratory safety a legal requirement in the united states of america? After administering medication to a client subcutaneously, the nurse removes the needle at the same angle at which it was inserted. which explains the nurse's action? Which atoms has smaller ionization energy What is the wavelength, in nanometers, of the bright line of the hydrogen emission spectrum corresponding to the following transition?. Why Is Decission Necesarry? 2. Asbestos was ---- used in construction before 1980, so any building material more than 20 years old should be handled very carefully.accordinglywidelyfortunatelyunacceptably