About how many new species did the HMS Challenger find during its journey around the world?

Answers

Answer 1

Answer:

the years 1873–76 which, among many other discoveries, catalogued over 4,000 previously unknown species.

Explanation:

Answer 2
4,000 species this is right

Related Questions

1 2 3 4 5 6
Chapter 2 (2.1) Study Guide
Directions: Answer the questions using your notes and study for them for the test along with
your worksheets. Make sure to submit your answers in google classroom before your block
begins.
1. Anything that has mass and volume
matter
2. The smallest functional unit of matter
3. An atom has 3 subatomic parts:
4.
carry a positive charge and are located in the
5. When two compounds are placed together and the result is something new, we know a
reaction has taken place.
6. Label the following examples as physical or chemical changes:
a. Burning paper
b. Nail rusting

Answers

Answer:

The smallest functional unit of matter: Atoms

An atom has 3 subatomic parts: Electrons, neutrons, and protons.

PROTONS carry a positive charge and are located in the: center of the nucleus in the atom.

Explanation:

HELP QUICK PLEASE!!!!!

Answers

Answer:

try C

Explanation:

it supports laws that protect the public from environmental hazards

What contributes to water's unique properties as a universal solvent, temperature moderator, and cohesive behavior? Hydrogen is a special element that does not have neutrons. The oxygen atoms of water molecules attract electrons more than hydrogen atoms. The properties are related to the crystalline structure of liquid water. The properties are related to the high electronegativity of hydrogen atoms. i think is B

Answers

Answer:

The oxygen atoms of water molecules attract electrons more than hydrogen atoms.

Explanation:

The uniqueness of water as a chemical substance is attriuted to its unique properties. These properties include being a universal solvent, having a high specific heat (temperature moderator), cohesive and adhesive nature etc.

This wonderful properties of water is due to its POLAR nature, which is when a substance has both positively and negatively charged parts to it. This is possible because the oxygen atoms (O) of water molecules attract electrons more than hydrogen atoms (H).

This POLARITY of water molecule is responsible for the HYDROGEN BONDING between water molecules and hence, contributes to the properties of water mentioned in the question (universal solvent, temperature moderator, and cohesive behavior)

Plz help I will mark you brainlist plz ​

Answers

Answer:

ISOTOPES

the same number of protons

but difference numbers of neutrons

IONS

because they have lost or gained one or more electrons

Answer:

atoms of the same element have same proton number but different nucleon number I hope this help u if u want more ask me

Commodity processors extract juice from oranges and
it in order to kill microbes and slow spoilage.

Answers

Answer:

Microbes

Explanation:

what are some alternatives to plastic
What are some alternatives for plastic

Answers

Answer:

paper, like instead of plastic straws you could use paper ones instead

Explanation:

Glass

Reusable Shopping Bags

Plastic Additives

Milk Protein

Grape Waste

Liquid Wood

PCL Polyesters

PHA Polyesters

PLA Polyesters

Starch-based Polymers

Hope this helps!! <3

What are some human interactions that are harming both the carbon and nitrogen cycles?

Answers

pollution is one of the options

Im crying because im so in a hurry help me fastas you can in this science question.

Answers

energy convention: Convection is the motion of a fluid driven by temperature differences across that fluid. When a fluid is heated, the region in closest contact with the heat source becomes less dense due to increased kinetic energy in the particles. Convection is one of the fundamental ways that heat is transferred

Who was the first person to see cells under the microscope and give them name a Robert Hooke b Theodor Schwann c Anton van Leeuwenhoek d Matthias Schleiden

Answers

Answer:

a) Robert Hooke

Explanation:

The cell was first discovered by Robert Hooke in 1665, which can be found to be described in his book Micrographia. In this book, he gave 60 'observations' in detail of various objects under a coarse, compound microscope.

The first person to observe the cell under the microscope is Robert Hooke, who is present in Option a. Robert Hooke is the person who first observed cork cells under the microscope and gave them a name. Option a is correct

What is a cell?

In the early stages of the earth, cells were not as developed as those of today's eukaryotes; they had RNA as genetic material, and later by evolution, today's eukaryotic cells developed. Those RNA-containing cells were extremely susceptible to mutation, whereas today's DNA-containing cells are not.

The eukaryotic cell contains numerous organelles that perform various functions, such as the lysosome, which degrades pathogens, the chloroplast of plants, which perform photosynthetic reactions, the nucleus of eukaryotic cells, which conserves DNA, and the mitochondria, which generate energy through cellular activities.

Hence, the first person to observe the cell under the microscope is Robert Hooke and gave them a name, who is present in Option a.

Learn more about the cell here.

https://brainly.com/question/12129097

#SPJ5

A student wants to create a liquid volcano. The student observes bubbles in the soft drink prior to opening it. The student first proceeds to open the soft drink bottle and place it on the floor. Next the student drops candy tablets into the drink using a rolled piece of paper, so that the tablets are able to fall into the drink continuously. The student notices a very powerful reaction as the drink fizzes and starts to bubble. In this scenario, what would be the catalyst ?

Answers

Answer: the candy tablets being added to the drink

Explanation: i’m on the test right now and that’s what seems more logical

Answer:

A student wants to create a liquid volcano. The student observes bubbles in the soft drink prior to opening it. The student first proceeds to open the soft drink bottle and place it on the floor. Next the student drops candy tablets into the drink using a rolled piece of paper, so that the tablets are able to fall into the drink continuously. The student notices a very powerful reaction as the drink fizzes and starts to bubble. In this scenario, what would be the catalyst ?

A: The candy tablets being added to the drink

Please help I’m dumb

Answers

Answer:

is this science.I love science.I will tell you tommorow

Lakes, rivers, or springs can form when

Answers

Lakes can form when underground deposits of soluble rocks are dissolved by water running through the area, making a depression in the ground. Rock formations made of sodium chloride (salt), or calcium carbonate (limestone), are most likely to be dissolved by acidic waters.

Answer:

A river forms from water moving from a higher elevation to a lower elevation, all due to gravity. When rain falls on the land, it either seeps into the ground or becomes runoff, which flows downhill into rivers and lakes, on its journey towards the seas. In most landscapes the land is not perfectly flat—it slopes downhill in some direction.

Lakes can be formed when glaciers melt, craters from meteorites or rivers.

springs when rainwater or groundwater is heated by magma underneath Earth's surface.

Explanation:

release energy to
2. Chemical reactions that take place in
carry out cell processes.

Answers

Answer:

Explanation:

All organisms require energy to complete tasks; metabolism is the set of the chemical reactions that release energy for cellular processes.hope it helps......

Which order shows the levels of organization from smallest to largest?
O cell organ tissue organ system organism O cell tissue organ organ system organism
O cell organ system organ tissue organism
O cell organ organ system SHAK tissue organism​

Answers

Answer:

Cell tissue organ to organ systems

...........

Answer:

Cell tissue organ to organ systems

hope this helps

If a carbon atom is bonded to two hydrogen atoms and two carbon atoms, what type of bond must exist between the
carbon atoms?
O single
O double
O triple
O quadruple

Answers

the answer is A. single .

Phosphorus is mainly stored in the

Answers

Answer:

Phosphorus is mainly stored in the  soil and rocks in the form of phosphate.

Explanation:

i hope this helps

3. Write the complimentary sequence of DNA for the following strand:
5'-AATTAGGAGCCCAGCTTTGCCGA-3'

Answers

The correct answer is TTAATCCTCGGGTCGAAACGGCT

This is because whenever you’re trying to find the complementary sequence of DNA, you basically switch which the listed base and it’s correspondent.

Adenine -> Thymine
Cytosine -> Guanine

Hope this helps!! :)

In activity c, you explored how temperature affects the concentration of dissolved oxygen in a pond use the three data points you collected for the cold Pond to determine the mean dissolved oxygen of the cold pond

Answers

Answer:

Add the three data and divided by 3.

Explanation:

Temperature has a great affects on the concentration of dissolved oxygen in a pond because temperature is responsible for the presence of high amount of dissolved oxygen in water. At low temperature such as in winter season, the amount of dissolved oxygen in water is higher while in warm temperature such as in summer season, the concentration of dissolved oxygen is lower. So   for measuring the mean dissolved oxygen of the cold pond, you have to add the data and then divided by 3, you will get the average dissolved oxygen of the cold pond.

If one strand of the DNA reads:
ATCCGCAT
What will the complementary strand be?

Answers

Answer:

in rna the strand would be    UAGGCGUA

G goes with C and A goes with U ( unless there is a T within the strand already then its an A that airs up with it )

Explanation:

but if its in DNA the strand will be     TAGGCGTA

G goes with C        T goes with A

Answer:

TAGGCGTA

Explanation: A with T: the purine adenine (A) always pairs with. the pyrimidine thymine (T) C with G: the pyrimidine cytosine (C) always pairs with. the purine guanine (G)

lipids are used for long term energy storage in that fat cells or organism and can also act as an insulator in the winter time ?

true or false ​

Answers

Answer:

never heard of an question like this

Which of the following could be a sequence in the carbon cycle?

Answers

Answer:

plants take in carbon dioxide and produce glucose --> animals consume plants --> animals break down glucose and release carbon dioxide

Explanation:

The carbon cycle is the sequence through which carbon is cycled through ecosystems. The carbon cycle usually occurs in the following order:

First, plants take in carbon dioxide and convert it to glucose.

Then, animals consume plants and break down glucose through the process of respiration.

Finally, this process releases carbon dioxide back into the atmosphere, and the cycle continues.

If a squirrel climbs a tree at 16m/s how many meters will it travel every hour ? ____ m/hr

Answers

Answer:

57600

Explanation:

16x60x60

Brainiest please :D

The distance travelled per hour by the squirrel as it climbs a tree at 16m/s is :  57600m/hr

Determine the distance travelled every hour

Given data :

velocity = 16m/s

To determine the distance travelled per hour

16 m * 60secs * 60 minutes

= 16 * 60 * 60

= 57600 m

Hence we can conclude that the The distance travelled per hour by the squirrel as it climbs a tree at 16m/s is :  57600m

Learn more about Velocity : https://brainly.com/question/4931057

#SPJ2

Plsss helps plss

Extra 20 points

Answers

A is the answer I’m sure because I just took the test

Rice, wheat, soybeans, and _______ are considered the four angiosperms that are responsible for early agriculture.

Answers

Answer:

Corn

Explanation:

I'm not 100% sure so lmk ig I'm right or wrong

Answer:corn

Ethylene

dormant

anther

stigma

fruit

temperature

Wind pollination required a great deal of excess pollen, just so some of it lands, by chance, in the right place. Animal pollination is more selective because animals pick pollen up and carry it directly to where it needs to be. Although there is still a chance that the pollen will be from the wrong plant species, plants can manipulate variations in animal behavior through the structures of their flowers, the time and season of flowering, or the rewards or attractive chemicals they produce to narrow the field of pollinators, and increase the chances of having exactly the right pollen put in exactly the right place.

Explanation:

Why is it beneficial for the earth to have both autotrophic and hypertrophic?

Answers

Because it will create balance on the earth. For example if there are only autotrophs there will be competition for nutritious and space for the roots to grow .Also for the heterotrophs, the harbivous will be hard for them to find plants to eats eventually it will lead to starvation then death and their death will affect carnivores because the organisms that they used to hunt are all dead now. So when there is a balance between autotrophs and heterotrophs they will help each other to survive.

What do paleontologists do when they uncover incomplete fossils

Answers

Answer:

Explanation:

Paleontologists are scientists that study the history/existence of past lives by collecting and examining fossils. They use these fossils to determine the history and age an organism has existed. Fossils are remains of dead organisms (plants and animals) which serve as evidence of past lives that have existed on earth in the past. They could include bone remains or footprint of this animals.

Fossils (from bones) are however mostly incomplete because they decompose before they are "stored naturally" by sediments which covers them. When scientists discover this incomplete fossils, they are compared (if there has been similar fossils discovered before then) and are stored and transferred to the lab for examination. This examination includes anatomical comparison (to determine relatedness with other fossils/organisms), carbon dating (to determine age) and data comparison (which includes location and type of soil and habitat).

Charles Hillman, an associate professor at the University of Illinois, is conducting research into why children are better at problem-solving after exercise. He places 20 kids, approximately 10 years of age, on a treadmill for 20 minutes. Another group of 10-year-old kids sits in a chair for 20 minutes. Dr. Hillman then measures the brain wave activity of both groups. The group who exercised showed a 5% increase in the P3 waves, which occur during decision- making. What would need to be done in order to make this experimental outcome accepted in the scientific community? Group of answer choices More time would need to be allowed for the experiment. Other scientists would need to confirm the results by performing the same experiment. The same test would have to be done using a different type of exercise. Girls and boys would need to be tested separately and then together.

Answers

Answer:

Other scientists would need to confirm the results by performing the same experiment.

Explanation:

According to this question, an experiment was conducted by an associate professor, using 20kids, to discover why children are better at problem-solving after exercise. He arrived at a result that Children who exercised showed a 5% increase in the P3 waves, which occur during decision- making.

However, in order for this findings by Charles Hillman to be generally accepted and recognized in the scientific community, which is a connection of several scientists, the results need to be confirmed by performing the same tests or experiment.

Note that, an experiment becomes a scientific theory if it has undergone series of repeatable tests. One of the key features of scientific experiment is that it must be repeatable.

Small-chain fatty acids can enter the bloodstream directly, but large-chain fatty acids must be packaged first before entering the . can be carbohydrate-, protein-, or fat-based. remove cholesterol from tissues and deliver it to the liver for use in bile or excretion. Linoleic acid and alpha-linolenic acid are considered , and must be obtained from the diet. is needed to help mix fats with watery fluids. Carriers that transport monoglycerides and fatty acids to intestinal cells are called . contains 6 to 8 fatty acids connected to sucrose, and cannot be broken down by digestive enzymes. A is a lipoprotein carrier that transports digested fat and other lipids through the lymph system.

Answers

Answer:

lymph

fat substitutes

high-density lipoproteins

essential fatty acids

emulsification (bile)

micelles

olestra

chylomicron

Explanation:

Short-chain fatty acids can be absorbed directly into the bloodstream by the intestine capillaries, while long-chain fatty acids are released into the tiny intestine. Fat substitutes are chemical compounds that have similar properties of fats and oils, with fewer calories than fat. High-density lipoproteins (HDL) are referred as "good" cholesterol because they transport cholesterol from other body parts back to the liver. The alpha-linolenic acid and linoleic acid correspond to omega-3 and omega-6 fatty acids, respectively, and they are essential fatty acids that need to be consumed in the human diet. Emulsification is a chemical process consisting of mixing two immiscible liquids to form a semistable mixture. Micelles are chemical structures formed by the agglomeration of mixed lipids and bile acids, which support the action of lipases for digesting lipids. Olestra is a fat substitute that can be used in low-calorie diets for weight control. Finally, chylomicrons are ultra low-density lipoproteins (ULDLs) composed of triglycerides, phospholipids, cholesterol and proteins. The ULDLs are produced by intestinal cells.

Climate is a global factor that produces

A. Earth’s unique ocean and atmosphere.
B. the shape and elevation of landmasses.
C. a wide range of environmental conditions that shape communities.
D. solar energy within the atmosphere.

Answers

Answer:

C. a wide range of enviromental conditions that shape communitites

Explanation:

Climate is a global factor that produces a wide range of environmental conditions that shape communities. Option C.

Climate as a global factor

Climate is a global factor that generates a wide range of environmental conditions, including temperature, precipitation patterns, humidity, wind patterns, and seasonal variations.

These environmental conditions play a crucial role in shaping the structure and dynamics of ecosystems and the distribution of organisms. Climate influences factors such as the types of vegetation, availability of water resources, and the adaptability and survival of various species.

It affects the composition and characteristics of communities and ecosystems, making it a key factor in ecological processes and biodiversity.

More on climate change can be found here: https://brainly.com/question/33588826

#SPJ6

After spending a year in India, Giovanna returns home to the United States and is inspired to raise money to help her new friends build a school. She makes a pitch to the Rotary Club in her hometown. This was the best experience of my life. Not only did I get to learn about a new culture and explore new ideas, but I am learning to speak their language. But don’t just take my word for it. I’ve asked the children to join us today from India through web-conferencing, and they’d like to say a few words.

Answers

Answer:

A. improve the conditions of people in other countries.

Answer:

A

Explanation:

took the quiz

Other Questions
A gambler plays roulette 100 times betting $1 on two numbers, 7 and 11, each time. If the ball lands on either 7 or 11 then gambler wins $17, if the ball lands on any of the other 36 numbers the gambler loses $1. The roulette wheel has 38 slots numbered 1-36, 0, and 00 a) Which is the appropriate box model? 1. The box has 38 tickets: 1 marked "7" and 1 marked "11" and the rest marked 2. The box has 38 tickets: one each of 1,2,3,...36,0, and 00 3. The box has 38 tickets: 2 marked "17" and 36 marked 4. The box has 38 tickets:2 marked "17" and 36 marked "-1" Thomas buys 5 sandwiches and 2 drinks at the deli. He knows hespent $4.50 on the drinks and the total was $35.75. Write and solve anequation to determine the price of each sandwich. Question 3. The smallest digit bywhich *' should be replaced in710*95, so that the number formed isdivisible by 3 is: Function h is a transformation of the parent exponential function, f(x) =2^xh(x) = -32^xwhich statement is true?A. function h is a reflection and a translation of function fB. function h is a horizontal translation of function fC. function h is a reflection and a dilation of function fD. function h is a vertical translation of function f A point-by-point comparison is structured so that the writer Write the expression (-7) (7)5. 5. 5. 5 using exponents.please help!! The Sardinian's eat unleavened wheat, grass feed beef to make cheese and foods full of Polyphenols NEED HELP ASAP PLEASE !!!!!!!!!!!!!!!!!!!!!Answer the following questions about the letter:1) What is Lincoln saying in the first paragraph?2) Bracket the sentences which show he has left no doubt as to what his goal is?3) Underline what he says he will not save the Union.4) What is Lincolns personal wish?5) Explain why Lincoln would not follow his conscience on this matter.6) Compare differences in the form of Lincolns letter to the form used today.Executive Mansion,Washington, August 22, 1862.Hon. Horace Greeley:Dear Sir.I have just read yours of the 19th. addressed to myself through the New-York Tribune. If there be in it any statements, or assumptions of fact, which I may know to be erroneous, I do not, now and here, controvert them. If there be in it any inferences which I may believe to be falsely drawn, I do not now and here, argue against them. If there be perceptable [sic] in it an impatient and dictatorial tone, I waive it in deference to an old friend, whose heart I have always supposed to be right.As to the policy I "seem to be pursuing" as you say, I have not meant to leave any one in doubt.I would save the Union. I would save it the shortest way under the Constitution. The sooner the national authority can be restored; the nearer the Union will be "the Union as it was." If there be those who would not save the Union, unless they could at the same time save slavery, I do not agree with them. If there be those who would not save the Union unless they could at the same time destroy slavery, I do not agree with them. My paramount object in this struggle is to save the Union, and is not either to save or to destroy slavery. If I could save the Union without freeing any slave I would do it, and if I could save it by freeing all the slaves I would do it; and if I could save it by freeing some and leaving others alone I would also do that. What I do about slavery, and the colored race, I do because I believe it helps to save the Union; and what I forbear, I forbear because I do not believe it would help to save the Union. I shall do less whenever I shall believe what I am doing hurts the cause, and I shall do more whenever I shall believe doing more will help the cause. I shall try to correct errors when shown to be errors; and I shall adopt new views so fast as they shall appear to be true views.I have here stated my purpose according to my view of official duty; and I intend no modification of my oft-expressed personal wish that all men everywhere could be free.Yours,A. Lincoln. The first coin I pull from my bag is a penny, the second coin I pull from my bag is a penny therefore I reason that all the coins in my bag are pennies. This is an example of a Deductive reasoning b Inductive reasoning how many molecules of O2 are required? Please help me I will give out extra pointsColonists viewed enslaved people as property. They did not regard them as humans. They did not get paid for the back-breaking labor they performed. They were bought and sold much like animals or equipment. This is an example of a(n)- Question 7 options: social effect of slavery. economic effect of slavery. environmental effect of slavery. political effect of slavery. Who claimed that Anselm wrongly assumed that existence was a real property?A. David Hume.B. Immanuel Kant.C. John Locke.D. Gaunilo of Marmoutiers. All of the following are effects of crossing over of homologous chromosomes during prophase I of meiosis with the EXCEPTION of Put these numbers in order from least to greatest.-1, 21/28, -22/25 (xvii)What is meant by PICIC? Mi casa es su casa" es una expresin que se usa para decir que todos _[blank]_. Qu opcin completa la oracin lgicamente? What is the IP address of the second Ethernet adapter? How to convert 60% to a decimal Evaluate the expression:(4 * 5)2 6 + 3 = (pls help) The scale factor of a doll house from the actual house is 35:1. If one of the windows of the doll house has a width of inch, what is the measure of the width of the window on the actual house?a. 14 in.b. 9 in.c. 8 in.d. 12 in.