An enzyme known as amylase is found in the saliva of humans. This enzyme helps to begin the process of digesting starch molecules in the foods we eat. Which of these BEST describes how enzymes like amylase help in the process of digestion? (AKS 1a1) Question 2 options: Amylase contains the DNA molecules necessary to assemble the proteins needed for digestion. Amylase is a catalyst that speeds up the chemical process of breaking down food molecules. Amylase breaks down the food molecules directly by forming powerful acids. Amylase acts as a buffer to keep the pH of foods at a consistent level.

Answers

Answer 1

up the  chemical process of breaking down food molecules.Answer:

Amylase is a catalyst that speeds up  that speeds

Explanation:


Related Questions

What do paleontologists do when they uncover incomplete fossils

Answers

Answer:

Explanation:

Paleontologists are scientists that study the history/existence of past lives by collecting and examining fossils. They use these fossils to determine the history and age an organism has existed. Fossils are remains of dead organisms (plants and animals) which serve as evidence of past lives that have existed on earth in the past. They could include bone remains or footprint of this animals.

Fossils (from bones) are however mostly incomplete because they decompose before they are "stored naturally" by sediments which covers them. When scientists discover this incomplete fossils, they are compared (if there has been similar fossils discovered before then) and are stored and transferred to the lab for examination. This examination includes anatomical comparison (to determine relatedness with other fossils/organisms), carbon dating (to determine age) and data comparison (which includes location and type of soil and habitat).

Im crying because im so in a hurry help me fastas you can in this science question.

Answers

energy convention: Convection is the motion of a fluid driven by temperature differences across that fluid. When a fluid is heated, the region in closest contact with the heat source becomes less dense due to increased kinetic energy in the particles. Convection is one of the fundamental ways that heat is transferred

why did europeans want to conquer the new world ?

Answers

Answer:

Europeans wanted to explore the world so that they could gain wealth. European rulers fought many wars and they were very expensive so they needed to find gold, silver and precious stones to pay for them.

Explanation:

This is a timeline depicting the development of atomic ___________. What word should be used to fill in the blank? Support your choice with evidence. A) Law. At each interval on the timeline, scientists described the patterns they saw in both atomic and subatomic structure. Eliminate B) Law. Scientists used observation, experimentation, and mathematical models to explain atomic stricter and the behavior of subatomic particles. C) Hypothesis. Scientists conducted experiments at each interval. They made educated guesses regarding atomic structure and then experimented to support or rejected the hypotheses. D) Theory. At each interval on the timeline, scientists made observations and conducted experiments to explain how atoms and/or subatomic particles behaved in order to determine atomic structure.

Answers

Answer:

Subatomic particle, also called elementary particle, any of various self-contained units of matter or energy that are the fundamental constituents of all matter. Subatomic particles include electrons, the negatively charged, almost massless particles that nevertheless account for most of the size of the atom, and they include the heavier building blocks of the small but very dense nucleus of the atom, the positively charged protons and the electrically neutral neutrons. But these basic atomic components are by no means the only known subatomic particles. Protons and neutrons, for instance, are themselves made up of elementary particles called quarks, and the electron is only one member of a class of elementary

Explanation:

because it is

it's d lol

Theory. At each interval on the timeline, scientists made observations and conducted experiments to explain how atoms and/or subatomic particles behaved in order to determine atomic structure. Let's take one example: Rutherford's gold foil experiment. Based on observing the behavior of alpha particles directed at a gold foil screen, Rutherford determined that an atom consisted of mostly empty space, with all of its positive charge concentrated in its center in a very tiny volume, surrounded by a cloud of electrons. Yet, further experimentation eventually lead to another model and another theory of atomic structure.

Commodity processors extract juice from oranges and
it in order to kill microbes and slow spoilage.

Answers

Answer:

Microbes

Explanation:

Plz help I will mark you brainlist plz ​

Answers

Answer:

ISOTOPES

the same number of protons

but difference numbers of neutrons

IONS

because they have lost or gained one or more electrons

Answer:

atoms of the same element have same proton number but different nucleon number I hope this help u if u want more ask me

what are some alternatives to plastic
What are some alternatives for plastic

Answers

Answer:

paper, like instead of plastic straws you could use paper ones instead

Explanation:

Glass

Reusable Shopping Bags

Plastic Additives

Milk Protein

Grape Waste

Liquid Wood

PCL Polyesters

PHA Polyesters

PLA Polyesters

Starch-based Polymers

Hope this helps!! <3

3. Write the complimentary sequence of DNA for the following strand:
5'-AATTAGGAGCCCAGCTTTGCCGA-3'

Answers

The correct answer is TTAATCCTCGGGTCGAAACGGCT

This is because whenever you’re trying to find the complementary sequence of DNA, you basically switch which the listed base and it’s correspondent.

Adenine -> Thymine
Cytosine -> Guanine

Hope this helps!! :)

A student wants to create a liquid volcano. The student observes bubbles in the soft drink prior to opening it. The student first proceeds to open the soft drink bottle and place it on the floor. Next the student drops candy tablets into the drink using a rolled piece of paper, so that the tablets are able to fall into the drink continuously. The student notices a very powerful reaction as the drink fizzes and starts to bubble. In this scenario, what would be the catalyst ?

Answers

Answer: the candy tablets being added to the drink

Explanation: i’m on the test right now and that’s what seems more logical

Answer:

A student wants to create a liquid volcano. The student observes bubbles in the soft drink prior to opening it. The student first proceeds to open the soft drink bottle and place it on the floor. Next the student drops candy tablets into the drink using a rolled piece of paper, so that the tablets are able to fall into the drink continuously. The student notices a very powerful reaction as the drink fizzes and starts to bubble. In this scenario, what would be the catalyst ?

A: The candy tablets being added to the drink

What kind of mineral ID is this?

please hurry !! thank you :)

Answers

Answer:

Cleavage and Fracture

Explanation:

Cleavage is the way a mineral breaks. Many minerals break along flat planes, or cleavages—some in only one direction (like mica), others in two directions (like feldspar), and some in three directions (like calcite) or more (like fluorite). Some minerals, like quartz, have no cleavage. Cleavage is a profound property that results from a mineral's molecular structure, and cleavage is present even when the mineral doesn't form good crystals. Cleavage can also be described as perfect, good or poor.

If a carbon atom is bonded to two hydrogen atoms and two carbon atoms, what type of bond must exist between the
carbon atoms?
O single
O double
O triple
O quadruple

Answers

the answer is A. single .

Which of the following could be a sequence in the carbon cycle?

Answers

Answer:

plants take in carbon dioxide and produce glucose --> animals consume plants --> animals break down glucose and release carbon dioxide

Explanation:

The carbon cycle is the sequence through which carbon is cycled through ecosystems. The carbon cycle usually occurs in the following order:

First, plants take in carbon dioxide and convert it to glucose.

Then, animals consume plants and break down glucose through the process of respiration.

Finally, this process releases carbon dioxide back into the atmosphere, and the cycle continues.

What does a targeted digestive capsule mean?

Answers

Targeted to help just that the (digestive system) a digestive capsule is a coated tablet that is digested

Are fungi Producers or Consumers?

Answers

Answer:

Bacteria and fungi are actually decomposers. They eat decaying matter - dead plants and animals and in the process they break them down and decompose them.

Fungi it’s a decomposer because it decomposes the bodies of dead plants and animals.

I will give brainliest!!!!!!!
Protein synthesis can occur on the rough endoplasmic reticulum (ER) but not on the smooth ER.

Which cell structures are attached to the surface of the rough ER that allow it to make proteins?

Choose 1 answer:

A
DNA strands

(Choice B)
B
Vacuoles

(Choice C)
C
Chloroplasts
(Choice D)
D
Ribosomes

Answers

Answer:

The answer is b

Climate is a global factor that produces

A. Earth’s unique ocean and atmosphere.
B. the shape and elevation of landmasses.
C. a wide range of environmental conditions that shape communities.
D. solar energy within the atmosphere.

Answers

Answer:

C. a wide range of enviromental conditions that shape communitites

Explanation:

Climate is a global factor that produces a wide range of environmental conditions that shape communities. Option C.

Climate as a global factor

Climate is a global factor that generates a wide range of environmental conditions, including temperature, precipitation patterns, humidity, wind patterns, and seasonal variations.

These environmental conditions play a crucial role in shaping the structure and dynamics of ecosystems and the distribution of organisms. Climate influences factors such as the types of vegetation, availability of water resources, and the adaptability and survival of various species.

It affects the composition and characteristics of communities and ecosystems, making it a key factor in ecological processes and biodiversity.

More on climate change can be found here: https://brainly.com/question/33588826

#SPJ6

Phosphorus is mainly stored in the

Answers

Answer:

Phosphorus is mainly stored in the  soil and rocks in the form of phosphate.

Explanation:

i hope this helps

Which of the following is a function of proteins? (AKS 1a)
O A.
A. long term energy storage
O
B. help with slowing down chemical reactions
O
C. build tissues such as bone and muscle
O
D. raise activation energy and lower reaction rate

Answers

Answer:

ans is A long term energy

storage

Long term energy storage

If a squirrel climbs a tree at 16m/s how many meters will it travel every hour ? ____ m/hr

Answers

Answer:

57600

Explanation:

16x60x60

Brainiest please :D

The distance travelled per hour by the squirrel as it climbs a tree at 16m/s is :  57600m/hr

Determine the distance travelled every hour

Given data :

velocity = 16m/s

To determine the distance travelled per hour

16 m * 60secs * 60 minutes

= 16 * 60 * 60

= 57600 m

Hence we can conclude that the The distance travelled per hour by the squirrel as it climbs a tree at 16m/s is :  57600m

Learn more about Velocity : https://brainly.com/question/4931057

#SPJ2

Who was the first person to see cells under the microscope and give them name a Robert Hooke b Theodor Schwann c Anton van Leeuwenhoek d Matthias Schleiden

Answers

Answer:

a) Robert Hooke

Explanation:

The cell was first discovered by Robert Hooke in 1665, which can be found to be described in his book Micrographia. In this book, he gave 60 'observations' in detail of various objects under a coarse, compound microscope.

The first person to observe the cell under the microscope is Robert Hooke, who is present in Option a. Robert Hooke is the person who first observed cork cells under the microscope and gave them a name. Option a is correct

What is a cell?

In the early stages of the earth, cells were not as developed as those of today's eukaryotes; they had RNA as genetic material, and later by evolution, today's eukaryotic cells developed. Those RNA-containing cells were extremely susceptible to mutation, whereas today's DNA-containing cells are not.

The eukaryotic cell contains numerous organelles that perform various functions, such as the lysosome, which degrades pathogens, the chloroplast of plants, which perform photosynthetic reactions, the nucleus of eukaryotic cells, which conserves DNA, and the mitochondria, which generate energy through cellular activities.

Hence, the first person to observe the cell under the microscope is Robert Hooke and gave them a name, who is present in Option a.

Learn more about the cell here.

https://brainly.com/question/12129097

#SPJ5

Why is it beneficial for the earth to have both autotrophic and hypertrophic?

Answers

Because it will create balance on the earth. For example if there are only autotrophs there will be competition for nutritious and space for the roots to grow .Also for the heterotrophs, the harbivous will be hard for them to find plants to eats eventually it will lead to starvation then death and their death will affect carnivores because the organisms that they used to hunt are all dead now. So when there is a balance between autotrophs and heterotrophs they will help each other to survive.

Charles Hillman, an associate professor at the University of Illinois, is conducting research into why children are better at problem-solving after exercise. He places 20 kids, approximately 10 years of age, on a treadmill for 20 minutes. Another group of 10-year-old kids sits in a chair for 20 minutes. Dr. Hillman then measures the brain wave activity of both groups. The group who exercised showed a 5% increase in the P3 waves, which occur during decision- making. What would need to be done in order to make this experimental outcome accepted in the scientific community? Group of answer choices More time would need to be allowed for the experiment. Other scientists would need to confirm the results by performing the same experiment. The same test would have to be done using a different type of exercise. Girls and boys would need to be tested separately and then together.

Answers

Answer:

Other scientists would need to confirm the results by performing the same experiment.

Explanation:

According to this question, an experiment was conducted by an associate professor, using 20kids, to discover why children are better at problem-solving after exercise. He arrived at a result that Children who exercised showed a 5% increase in the P3 waves, which occur during decision- making.

However, in order for this findings by Charles Hillman to be generally accepted and recognized in the scientific community, which is a connection of several scientists, the results need to be confirmed by performing the same tests or experiment.

Note that, an experiment becomes a scientific theory if it has undergone series of repeatable tests. One of the key features of scientific experiment is that it must be repeatable.

NEED HELP ASAP!!!!

In trying to prove continental drift, Alfred Wegener used evidence from long ago to show that in the distant past, similar animal species lived in places that are ______today. For example, fossils of the________ were found in India, Africa, and Antarctica.

Answers

Wegener used Gondwana glaciation evidence, lithological and structural evidence, plates fitting together, and paleontological evidence to prove his theory. 1) separated 2)  Lystrosaurus.

What evidence used Wegener to prove his theory?

Since Wegener’s theory about continental drift was seriously criticized, he used a list of 10 pieces of evidence proposed by the geologist Du Toit that supported his theory.

The list includes Gondwana glaciation evidence, lithological and structural evidence, plates fitting together, and paleontological evidence.

Among the paleontological evidence, plant and animal fossils from the same species were found in currently separated continents. This distribution suggests the existence of a big unique supercontinent where these species used to inhabit.

For instance,

Glossopteris (fern) impressions are widely distributed in determined areas of Africa, South America, India, and Australia.

Terrestrial vertebrate fossils also support the theory. The presence of Triassic tetrapods in all continents suggests terrestrial corridors between landmasses.

Lystrosaurus ⇒ Triassic reptile ⇒ Found in Africa, India, and Antarctica

⇒ Mesosaurus ⇒ Triassic reptile ⇒ Found in South America and Africa

⇒ Cygnonathus ⇒ Triassic reptile ⇒ Found in South America and Africa

Finding these fossils on current different continents suggests that these landmasses were once together, and these species used to live in the same region.

With time, continents diverged and got separated by the ocean. The region where these species used to live got divided and fossils got separated.

In trying to prove continental drift, Alfred Wegener used evidence from long ago to show that in the distant past, similar animal species lived in places that are _separated_today. For example, fossils of the_Lystrosaurus_ were found in India, Africa, and Antarctica.

1) Separated

2) Lystrosaurus

You can learn more about Wegener evidences at

https://brainly.com/question/839947

https://brainly.com/question/9444622

#SPJ1

Rice, wheat, soybeans, and _______ are considered the four angiosperms that are responsible for early agriculture.

Answers

Answer:

Corn

Explanation:

I'm not 100% sure so lmk ig I'm right or wrong

Answer:corn

Ethylene

dormant

anther

stigma

fruit

temperature

Wind pollination required a great deal of excess pollen, just so some of it lands, by chance, in the right place. Animal pollination is more selective because animals pick pollen up and carry it directly to where it needs to be. Although there is still a chance that the pollen will be from the wrong plant species, plants can manipulate variations in animal behavior through the structures of their flowers, the time and season of flowering, or the rewards or attractive chemicals they produce to narrow the field of pollinators, and increase the chances of having exactly the right pollen put in exactly the right place.

Explanation:

SCIENCE- help me please I have to turn this in tonight PLEASE.............

Answers

Answer:

Yes,if it has a large mass it will have a large weight Awnser (2)

Which organelles are found in plant cells but not in animal cells?

Answers

Answer:

Organelles that are found in plant cells, and not in animal cells, are chloroplasts, a call wall, specialized plastids, and a large central vacuole.

Hope you found this helpful <3

Answer:

cell wall and chloroplast

Explanation: hope this helps:)

1. What makes water so unique?

Answers

Answer:

It is the reason the sky is blue

Explanation:

water helps you live, literally.

organisms that have many characteristics in common are grouped into a _______?

Answers

Organisms that have many characteristics in common are grouped into a ’species’ - hope this helped :)

Answer:

The are grouped in species...

Describe a non-biological hierarchy that exists in everyday life and how it relates to a biological system.


Answers

Answer:

A non-biological hierarchy could be the way the military is organized, with the soldiers at the very bottom and the big commanders on top. (I don't know the specific names for each of them) This relates to a biological heirarchy since the smaller, sadly less important things are at the bottom, like atoms and soldiers, and each group of soldiers makes a regiment (which would be a molecule), then a battalion (which would be a cell), then so on. (I dont know the order of the groups but you can look it up)

Accuracy is a measure of how close a value is to its true value. You can control accuracy by choosing the appropriate tool or instrument and using it carefully. How could the students in the following questions improve their accuracy? Tyrrell wanted to measure the growth of tomato plants in response to different types of fertilizer. Which tool would be most accurate?

Answers

Answer:Metric ruler

Explanation:

Answer:

1. Metric ruler

2. a pH meter can distinguish smaller differences in pH as compared to a pH strip.

Explanation:

Got those right on edge ;)

Other Questions
1) 13 + 3W - 9 + 16w How would the graph change if the b value in the equation is decreased but remains greater than 1? Translate the following phrase: Tom can spend no more than 20 dollars on his mom's birthday present. a) t>20 b) t In the sentence "Historically, energy sources for train locomotives have been horses, steam, gravity, electricity, and gas," "horses, steam, gravity, electricity, and gas" is a compound _________________. ndirect object direct object verb predicate nominative -J=34Help please please 6(42 +3)+5(22 +5) +5 = 34 + 48 A group of fitness club members lose a combined total of 28 kilograms in 1 week. There are approximately 2.2 pounds in 1 kilogram. Assuming the weight loss happened at a constant rate, about how many pounds did the group lose each day? 10. Which will likely affect a person's marital success?a. all of theseb. parental approvalc. religious beliefsd. how he/she celebrates holidays How are gas particles arranged in a container?1.Loosely arranged2.Neatly organized3.Tightly packed4.Far apart When 1580 is divided into 13 equal parts, the remainder is 7. What is a correct way to write the quotient? 121.7 121 + 7 1217 over 1580 1217 over 13 Can anybody help me with this bellwork?Manny is participating in a Bike-a-thon and travels at a constant rate of 6 miles in 20 minutes.1. How long will it take manny to travel 9 miles2. How long will it take manny to travel 10 miles? -2x 4 + 5x = 8 steps to solve The points (7,1) and (x, -4) lie on the same line. If the slope of the line is 1, what is the value of x? Tell whether 948 can be divided evenly(is divisible) by 4. Why do authors include repeated monologues in stories? One cell phone company offers a plan that costs $28.99 and includes unlimited night and weekend minutes. Another company offers a plan that costs $16.99 and charges $0.35 per minute during nights and weekends. For what numbers of night and weekend minutes does the second company's plan cost more than the first company's plan? Suppose point D is in the interior of ABC, mABC=12x110, mABD=3x+40, and mDBC=2x10. W 14x 45=613 what is x? What is the main idea of this passage? Factory workers are degraded at work and at home on a daily basis. Factory workers do not understand how to improve their conditions. Society needs to work to help factory workers improve their living conditions. With the help of reforms, cities would be a wonderful place to live and work. While most of the DNA in prokaryotic cell is stored in the nucleoid, there are also smaller bits of DNA called _____ floating free in the cytoplasm