Can someone help me

A situation that is commonly caused by acid rain is the dying off of fish and birds in freshwater habitats. Thus, the correct option for this question is B.

Acid rain may be defined as a type of precipitation that correspondingly include acidic components, like sulfuric acid, nitric acid, etc. that fall to the ground from the atmosphere in wet or dry forms like rain, fog, hail, etc.

The pH of acid rain is generally low compared to normal water. So, it causes numerous impacts on the earth's surface. But the most consequential influence of acid rain is the destruction of fish and birds in freshwater habitats.

It generally lowers the pH of the freshwater ecosystem and makes it unfavorable for many organisms like producers, small fishes, birds, etc. They cannot adapt themselves to such lower pH and have to dye off.

Therefore, the correct option for this question is B.

To learn more about Acid rain, refer to the link:

https://brainly.com/question/718250

#SPJ2

Answer:

whorls

Explanation:

Whorls. Whorls represent 34 percent of all fingerprint patterns. At least one ridge in a plain whorl pattern makes a complete circuit in the form of a circle, oval or spiral, and there must be at least two triangular shapes called deltas. ... Central pocket loop whorls make a complete circle inside the two deltas.

Answer:

A

Explanation: ok

Answer:

A

Explanation:

Answer:

The correct answer is - option B. DNA sequences from different species can be compared, giving us more information about their evolutionary relationships.

Explanation:

The study of the evolution of a species in a longer period of time and its evolutionary relation with other species is phylogeny. DNA is the basis of the molecular phylogeny of a species to find out the evolution of species.

Genetic mutations, a sequence of nucleotides, and other information of DNA helps in the establishment of divergence from common ancestry. By comparing the information it gives an idea about the evolutionary ancestry of two or more species.

Answer:

No,photosynthesis expend more energy than respiration

Answer:

Cell membranes, DNA, and Ribosomes

Hope this helps!!

Answer: Both prokaryotic and eukaryotic cells have structures in common. All cells have a plasma membrane, ribosomes, cytoplasm, and DNA.

plasma membrane, ribosomes, cytoplasm, and DNA.

Answer:

Carrying Capacity is very important for today as well as for the future.

Explanation:

Carrying Capacity refers to the maximum population of a particular organism that a specific environment can hold. In each and every environment, there are different population of organisms present due to the availability of resources such as food, water and space for living. If these resources are present in large amount then the population of organism will be higher but if these resources are limited, then the population will be lower. Carrying Capacity is also important for the future because with the passage of time, population of human increases which destroy the forests because human requires area for living. So for cutting of forests, the animals migrated to other areas and sometimes die due to no space available for them.

Answer:

yes!!!

Explanation:

An apple, potato, and onion all taste the same if you eat them with your nose plugged

A network of complex interactions formed by the feeding relationships among the various organisms in an ecosystem is known as Food web.

A food web is the natural interconnection of the different food chains and a graphical representation of what-eats-what in an ecological community in the nature. Another name used for the food web is the consumer-resource system.

Organisms which are present in the food webs are grouped into different categories are called as trophic levels. These levels are divided into producers, consumers, and decomposers.

Food web are the interactions which integrates the transfer of matter and energy between the living organisms which eat, and are being eaten by other organisms, capturing thus essential information about the species interactions, materials flow, community structure, and the ecosystem functioning.

Learn more about Food web here:

https://brainly.com/question/18816028

#SPJ6

Answer:

living thing

Explanation: the corrcet term for a living orgainsm is a living thing.

Explanation:

you got Animal or Creature or Being

Answer:

C

Explanation:

I'm pretty sure it's either C or B

Answer:

Starch-nucleic acid is not paired correctly.

Answer:

the ability to detect the direction of light, to make the right turn and to stay oriented, is a direct consequence of the helical path of the organism, the orientation of its eyespot relative to the helix-axis, and the special shielding properties of eyespot and cell body.

Explanation:

hope this helps :)

Chlamydomonas is an algae. It is a biflagellate organism. It can swim and therefore, exhibit phototaxis. Chlamydomonas needs to locate light in order to move and grow.

Chlamydomonas is a biflagellated algae which exhibits both positive and negative phototaxis. Phototaxis is the directional movement of an organism in response to light (stimulus).

The green alga, Chlamydomonas reinhardtii, can swim toward light (positive phototaxis) to increase photosynthesis, but it can also swim away from bright light (negative phototaxis) to avoid damage to molecular complexes required for photosynthesis.

Chlamydomonas grows at a faster rate with higher light intensity due to its photosynthetic nature, provided all other required nutrients for its growth are constant in all treatments. Light acts as an important factor for growth in these organisms.

Learn more about Chlamydomonas here:

https://brainly.com/question/920441

#SPJ2

2021 answers

1.  they both use energy transport chains

2. ATP

3. stored as chemical energy

4. carbon dioxide + water + light --> sugar + oxygen

5.  photosynthesis

100% :) please like if I am correct

Answer:

100% 2022

Explanation:

1.  they both use energy transport chains

2. ATP

3. stored as chemical energy

4. carbon dioxide + water + light --> sugar + oxygen

5.  photosynthesis

Answer:

can you give me a pic????

Answer:

Name Hafnium

Atomic Mass 178.49 atomic mass units

Number of Protons 72

Number of Neutrons 106

Number of Electrons 72

Answer: 72 protons, 178 neutrons, 106 electrons

Explanation:

Answer:

sorry, but there are no statements. Maybe you can edit it and add the pictures so we can see them.

The question is incomplete; the complete question is;

Root cells of plants take in some minerals from the surrounding soil by spending energy. After the plant obtains enough minerals to maintain health, the plant will continue to absorb minerals from the soil. Which reason best explains why root cells need to spend energy in order to transport some minerals into cells?

Root cells are unable to use sunlight energy for mineral uptake.

Mineral concentration is higher in root cells than in the surrounding soil

Cell membrane pores in roots are too small for passive uptake of minerals

Cell membranes in roots lack proteins for the passage of minerals.

Answer:

Mineral concentration is higher in root cells than in the surrounding soil

Explanation:

Mineral uptake by plant roots occurs by active transport of ions into the cells of root hairs, this process requires energy.

The concentration of minerals in the soil is quite low. The root hair cells of plants possess carrier proteins that carry mineral ions and move them into the cell against existing concentration gradient. This process requires energy and is known as active transport.

Answer:  B

Because i said so

The uneven heating of the Earth's surface leads to the formation of large global wind systems. The surface currents of the oceans are in turn driven by these global wind systems. Thus, option B is correct.

Large-scale surface ocean currents are propelled by global wind systems that are fuelled by solar energy. These currents transport heat from the tropics to the poles, altering the climate on a local as well as global scale.

Friction from the global winds, which both follow the same basic circulation, clockwise in the Northern Hemisphere and counterclockwise in the Southern Hemisphere.

Warm water and precipitation are transported from the equator to the poles by ocean currents, whereas cold water is returned to the tropics from the poles.

Therefore, The pattern of global ocean currents is one of the factors that drives global winds.

Learn more about global ocean currents here:

https://brainly.com/question/9896543

#SPJ2

Answer:

computer

Explanation:

it might just be a computer

Water; Inorganic compound

Oxygen; Element found in water

Carbon; Element that is part of most organic compounds

Carbohydrate; Energy-rich organic compound

Hope that helped!

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’

Answer:

The answer is B, zygote.

Answer:

The light-dependent reactions produce ATP and NADPH, which are then used by the light-independent reactions.

Light-dependent reactions and light-independent reactions both produce each set of sugars, and working together they produce more sugars than they can produce separately.

Light-dependent reactions which convert light energy into chemical energy, so the goal of the light-dependent reactions of photosynthesis is to collect energy from the sun and break down water molecules to form ATP and NADPH, while these two energy storage molecules occur which is used in light-independent reactions.

Light-dependent reactions occur in the thylakoid membrane that use light energy to make ATP and NADPH while in light-independent reactions or the Calvin cycle where electrons activated from light-dependent reactions provide energy to make carbohydrates from carbon dioxide molecules.

Thus, Light-dependent reactions and light-independent reactions both produce each set of sugars, and working together they produce more sugars than they can produce separately.

Learn more about Photosynthesis, here:

https://brainly.com/question/29764662

#SPJ2