Creative Solutions, Inc., has just invested $4,615,300 in new equipment. The firm uses a payback period criterion of rejecting any project that takes more than four years to recover its costs. Management anticipates cash flows of $644,386,$812,178,$943,279, $1,364,997,$2,616,300, and $2,225,375 over the next six years. (Round answer to 2 decimal places, e.g. 15.25.) What is the payback period of this investment? Payback period is years. Should Creative Solutions, Inc. go ahead with this project? The firm the project.

Answers

Answer 1

The Payback Period of an investment is the amount of time required for an investment to repay its initial costs. It measures the length of time for a project to recover its initial cost.

The formula for calculating payback period is:

Payback period = Initial Investment / Expected Annual Cash Inflows

1. The calculation of payback period

The initial investment is 4,615,300 and the cash flows for each year are as follows:

Year 1 = $644,386

Year 2 = 812,178

Year 3 = 943,279

Year 4 = 1,364,997

Year 5 = 2,616,300

Year 6 = 2,225,375

Using the formula above:

Payback period = Initial Investment / Expected Annual Cash Inflows

Payback period = 4,615,300 / 644,386 = 7.16 years

The payback period of this investment is 7.16 years.

2. The decision to undertake the project

Based on the company's payback period criterion, any project with a payback period greater than four years will be rejected.

The investment in this project is not acceptable because its payback period is more than four years.

Thus, Creative Solutions, Inc. should not go ahead with this project.

The Payback Period is an important measure to consider when deciding on whether or not to undertake an investment.

It helps the company to evaluate the investment's risk and return as well as the expected duration of the investment.

To know more about required visit :

https://brainly.com/question/2929431

#SPJ11


Related Questions

Recall that the shutdown condition is P < AVC. Should the
firm shutdown? Group of answer choices

Answers

The shutdown condition is P < AVC. If the firm is not able to cover its average variable costs, the company will be required to stop producing because it would lose more money by producing than it would by shutting down.

If a firm shuts down, it will not generate any revenue, and it will be necessary to pay all of the fixed costs. Even if the company is generating revenue and covering its variable costs, if it is unable to cover its fixed costs, it may still be forced to shut down.

The decision to shut down a business is based on the variable cost and revenue of a company. If the average variable cost is greater than the price of the product or service, the company should stop producing. When the price of the product is less than the AVC, the firm will lose money every time it produces.

To know more about producing visit:

https://brainly.com/question/30141735

#SPJ11

(PROJECT RISK MANAGEMENT)
In a rush for growth, companies find themselves dealing with an increased volume of contracts. Poor contract management can lead to unnecessary procurement of risks accompanied by financial and reputational losses.
(a) Discuss the pitfalls of poor contract management.

Answers

Poor contract management can lead to an increased risk of financial and reputational losses. This is because contracts are the foundation of most business relationships, and poorly written or mismanaged contracts can lead to a wide range of legal and financial complications.


In addition, poorly managed contracts can lead to poor communication between business partners, which can lead to lost opportunities and damaged relationships. Other potential pitfalls of poor contract management include the inability to enforce contractual obligations, the inability to track contract performance, and the inability to identify contract risks.

Companies that fail to properly manage their contracts may also be exposed to a wide range of other risks, such as regulatory non-compliance, breach of contract, and legal disputes. This can lead to reputational damage and loss of customer confidence, as well as significant financial losses.

To now more about contracts visit:

https://brainly.com/question/32149036

#SPJ11

________ refers to buying a packaged solution to a problem from a single seller, thus avoiding all the separate decisions involved in a complex buying situation.

Answers

The term that refers to buying a packaged solution to a problem from a single seller, thus avoiding all the separate decisions involved in a complex buying situation is called straight.

A straight  is when an organization reorders an existing product or service from the same supplier, with no additional negotiation. Straight  usually happens when a company is satisfied with the vendor's performance, pricing, and quality standards. It's a purchasing scenario in which the buyer reorders a product or service without making any changes to its original specifications or suppliers.

A straight is usually a routine and simple procedure that takes little time and resources and requires only minimal paperwork, processing, or decision-making on the buyer's part.Therefore, the buying situation, where buying a packaged solution to a problem from a single seller, thus avoiding all the separate decisions involved in a complex buying situation, is called straight.

To know more about packaged visit:

https://brainly.com/question/28283519

#SPJ11

A partner's liability for the iorts of their partners extends beyond those committed on company business. True False QUESTION 13 A principal is not bound in contract with the third party with whom the agent dealt if the agent is within her express authority. within her implied authority. within her apparent authority. outside her authority, but the principal ratified it. outside her actual and apparent authority. QUESTION 14 Claire has been selling her famous cookies on her own to local bakeries. Her cookies are so popular that she needs help with the packaging and delivery. Claire has taken no formal steps regarding the form of business organization. Claire's situation? Claire is unable to legally hire an employee until she takes steps to incorporate. Claire will be vicariously liable for the torts of her employee committed during the course of employment. The employee whom Claire hires will be, in law, a partner in Claire's business. The employee whom Claire hires will be liable for torts Claire commits during the course of the business. Claire's liability is limited to the value of the cookie business.

Answers

Partner's liability for the torts of their partners extends beyond those committed on company business. This statement is true. Explanation:A partner's liability for the torts of their partners extends beyond those committed on company business is a true statement.

It refers to the fact that every partner of a company has a certain liability, which is not only limited to the company's business, but also extends to the partners' activities outside of the company's business. This means that if one partner commits a tort outside of the company's business, all the other partners of the company will be liable for the actions of that partner.

The principal is not bound in contract with the third party with whom the agent dealt if the agent is outside her actual and apparent authority. This statement is true. Claire has been selling her famous cookies on her own to local bakeries. Her cookies are so popular that she needs help with the packaging and delivery.

Claire has taken no formal steps regarding the form of business organization. Claire will be vicariously liable for the torts of her employee committed during the course of employment. This statement is true.

To know more about company visit:

https://brainly.com/question/30532251

#SPJ11

According to Harris, precommitted traders:
a.
Other
b.
Offer liquidity to obtain better prices for trades they want to do
c.
Trade on price discrepancies between two or more markets
d.
Complete quick round-trip trades without assuming much inventory risk
e.
Buy and sell misvalued instruments
According to Harris, market makers:
a.
Trade on price discrepancies between two or more markets
b.
Other
c.
Offer liquidity to obtain better prices for trades they want to do
d.
Complete quick round-trip trades without assuming much inventory risk
e.
Buy and sell misvalued instrument

Answers

Harris has defined the terms precommitted traders and market makers and explains their role in the financial market. According to Harris, precommitted traders:

Precommitted traders are traders that give a guarantee that they will purchase or sell the securities of a specific issuer at a predetermined price in the future. The traders can be both small and big. It may include individuals, hedge funds, mutual funds, and other institutional investors. These traders provide liquidity to the market when they honor their promises.

They offer liquidity to obtain better prices for trades they want to do. Precommitted traders trade on price discrepancies between two or more markets. They can complete quick round-trip trades without assuming much inventory risk. They buy and sell misvalued instruments. According to Harris, market makers:Market makers are traders who are willing to buy and sell securities.

They are always ready to provide liquidity to the market. The difference between the price at which the market maker buys and the price at which the market maker sells securities is known as the spread. The profit of a market maker depends on the spread. Market makers provide liquidity to the market when there are fewer sellers or buyers. They offer liquidity to obtain better prices for trades they want to do.

Market makers trade on price discrepancies between two or more markets. They can complete quick round-trip trades without assuming much inventory risk. They buy and sell misvalued instruments.The above statements define precommitted traders and market makers and their role in providing liquidity to the market.

To know more about precommitted visit:

https://brainly.com/question/33573201

#SPJ11

every year approximately ____ businesses use a chapter 11 bankruptcy. a. 100,000 b. 500,000 c. 1 million d. 1.5 million e. 10,000

Answers

The main answer is d. 1.5 million.every year approximately 1.5 million businesses use a chapter 11 bankruptcy.

Approximately 1.5 million businesses use a Chapter 11 bankruptcy filing every year. Chapter 11 bankruptcy is a form of bankruptcy protection that allows businesses to reorganize their debts and continue operations while developing a plan to repay creditors. It is commonly used by large corporations and businesses facing financial distress to restructure their finances and avoid liquidation. The high number of Chapter 11 filings reflects the significant challenges and financial difficulties that many businesses encounter, leading them to seek bankruptcy protection as a means of addressing their financial issues and working towards financial stability.

learn more about:-  financial stability here

https://brainly.com/question/32559902

#SPJ11

In the hypothetical country of Westlandia, banks are required to hold 20% of checkable deposits as reserves. The public holds 50% of the loans as currency in circulation and redeposits the remaining 50% percent of the loans. a. Complete the table (calculations should be to no more than two decimal places). b. Calculate the new money supply. (Enter your response here.) c. Calculate the money multiplier. (Enter your response here.) 2. In the hypothetical country of Middlelandia, banks are required to hold 20% of checkable deposits as reserves. Also, the public holds none of the loans as currency in circulation and redeposits all the loans. a. Complete the table (calculations should be to no more than two decimal places). 4. Describe in detail the differences between the three hypothetical countries' money supplies, UNIT 8-BU204 - MACROECONOMICS money multipliers, and likely impacts on each economy. (Enter your response here.) 5. Explain how cach of the following situations changes the quantity of money (money supply) in the economy, based on its computed change in money supply. a. The Fedenal Reserve System buys bonds. (Enier your response here) b. The Fedenal Reserve System auctions credic. 5. Explain how each of the following situations changes the quantity of money (money supply) in the economy, based on its computed change in money supply. a. The Federal Reserve System buys bonds. (Enter your response here) b. The Federal Reserve System auctions credit. (Enter your response here.) c. The Federal Reserve System raises the discount rate. (Enter your response here) d. The Federal Reserve System raises the reserve requirement. (Enter your response here.)

Answers

Eastlandia has the lowest money supply and money multiplier compared to the other two countries since a higher percentage of loans are held as reserves rather than being put back into circulation.

5. Situations and how they change the money supply:

a. The Federal Reserve System buys bonds: The money supply increases because banks receive payment for their bonds in the form of reserves. These reserves can then be used to make new loans, increasing the money supply.

b. The Federal Reserve System auctions credit: The money supply increases since banks are able to borrow reserves from the Fed to make new loans.

c. The Federal Reserve System raises the discount rate: The money supply decreases since banks are less likely to borrow from the Fed at a higher interest rate.

d. The Federal Reserve System raises the reserve requirement: The money supply decreases because banks are required to hold more reserves, which means they have less money to lend out.

To know more about Westlandia visit:

https://brainly.com/question/30155829

#SPJ11

8. When considering whether to accept an audit engagement, it is important for the auditor to carry out the following:
evaluate the integrity of management
assess the competence of the audit team
identify special circumstances
evaluate independence and the ability to use due care
1, 2, and 3 only
1, 2, and 3 only
1, 2, 3, and 4
1, 2, 3, and 42,3,and 4 only
2,3,and 4 only
1,3 and 4 only

Answers

1, 2, 3, and 4 are the appropriate responses. When choosing whether to accept an audit engagement, the auditor will take all of these actions into account. The auditor should take the following actions when deciding whether to accept an audit engagement:

1. Assess the management team's honesty, morals, and reputation in order to determine its level of integrity. It is crucial to confirm that management is firmly committed to accurate financial reporting. 2. Evaluate the audit team's competence: The auditor must determine whether the audit team has the abilities, expertise, and knowledge required to carry out the engagement successfully. As a result, the audit will be carried out with the necessary level of skill. 3. Identify any unusual circumstances: The auditor should take into account any distinctive or complicated characteristics of the engagement that might call for extra resources or knowledge. This takes into account elements like legal or regulatory obligations, issues unique to the industry or significant alterations to the business.4. Assess independence and the capacity to exercise appropriate care. Independence is essential for upholding impartiality and objectivity throughout the audit. The auditor is required to determine whether there are any conflicts of interest or limitations on their independence. The auditor should also make sure they have the tools, knowledge, and time needed to conduct the audit with due care. 1, 2, 3, and 4 are the appropriate responses. When choosing whether to accept an audit engagement, the auditor will take all of these actions into account.

learn more about account here:

https://brainly.com/question/33477032

#SPJ11

sales revenue is $40,000, cost of goods sold is $11,000, and selling general and administrative expernses are $17,000. Variable costs are $8,000, Fixed costs are $20,000, and net operating income is $12,000. Contribution margin is:

Answers

The contribution margin is $32,000. Hence, option B is the correct answer.

To calculate the contribution margin, you need to subtract the variable costs from the sales revenue. The contribution margin represents the amount of revenue remaining after deducting the variable costs, which contributes towards covering fixed costs and generating a profit.

In this case, the sales revenue is $40,000, and the variable costs are $8,000.

Contribution Margin = Sales Revenue - Variable Costs

Contribution Margin = $40,000 - $8,000

Contribution Margin = $32,000

Therefore, the contribution margin is $32,000.

Learn more about contribution margin here:

brainly.com/question/29674918

#SPJ4

Sales revenue is $40,000, cost of goods sold is $11,000, and selling general and administrative expenses are $17,000. Variable costs are $8,000, fixed costs are $20,000, and net operating income is $12,000. Contribution margin is:

a. $27000

b. $32000

C. $23000

D. $20000

E. $30000

during april, the cost of goods manufactured was $74,000. the beginning finished goods inventory was $17,000 and the ending finished goods inventory was $14,000. what was the cost of goods sold for the month?

Answers

The cost of goods sold for the month of April is $81,000. This is calculated by adding the beginning finished goods inventory to the cost of goods manufactured and subtracting the ending finished goods inventory.

To calculate the cost of goods sold, we can use the following formula:

Cost of Goods Sold = Beginning Finished Goods Inventory + Cost of Goods Manufactured - Ending Finished Goods Inventory

Given:

Beginning Finished Goods Inventory = $17,000

Cost of Goods Manufactured = $74,000

Ending Finished Goods Inventory = $14,000

Substituting these values into the formula:

Cost of Goods Sold = $17,000 + $74,000 - $14,000

Cost of Goods Sold = $81,000

Therefore, the cost of goods sold for the month of April is $81,000.

To know more about inventory:

https://brainly.com/question/31146932

#SPJ4

Explain how automatic stabilizers work in Canadian economy. What are the options with government with an inflationary gãp caused by demand-pull inflation? Discuss each with specific examples. (Points: 10)

Answers

Automatic stabilizers are the policy tools that keep the economy stable by minimizing fluctuations in economic activity, particularly in the business cycle. They operate mechanically, which means they kick in during a recession, without requiring any action by the government.

In this case, the automatic stabilizer increases government expenditure and decreases taxes, resulting in higher aggregate demand and GDP. When the economy is in a boom, automatic stabilizers work in the opposite way; they decrease government expenditure and increase taxes, which results in a decrease in aggregate demand and GDP.

There are a few ways in which the government can manage an inflationary gap created by demand-pull inflation. The government has three primary options to combat inflation caused by demand-pull: fiscal policy, monetary policy, and price controls.

To know more about stabilizers visit:

https://brainly.com/question/32412546

#SPJ11

Profitability Index versus NPV. Consider projects A and B with the following cash flows: (【्ञ LO8-3) a. Which project has the higher NPV if the discount rate is 10% ? b. Which has the higher profitability index? c. Which project is most attractive to a firm that can raise an unlimited amount of funds to pay for its investment projects? d. Which project is most attractive to a firm that is limited in the funds it can raise?

Answers

Profitability Index (PI) vs Net Present Value (NPV)The profitability index (PI) is a method for determining the worth of a business investment.

The formula for the PI is the present value of future cash flows divided by the initial investment. On the other hand, NPV is a method for determining the net worth of a business investment. NPV is the difference between the present value of cash inflows and the present value of cash outflows. Project A and B cash flows are as follows:

Year    Project A   Project B0     (100,000)   (100,000)1     20,000      50,0002     30,000      30,0003     40,000      20,0004     50,000      10,000 Discount rate = 10%.

To compute NPV, the following formula is used: NPV = present value of cash inflows - initial investment. The present value is calculated by discounting future cash flows by the discount rate. To compute the profitability index, the following formula is used: PI = present value of cash inflows / initial investment

To calculate NPV, we must first discount each cash flow using the discount rate of 10% and sum up the present values.

Project A's NPV is as follows: Year 0 cash flow = -100,000

Present value of cash inflows:20,000 / (1 + 10%)^1 = 18,182.

8130,000 / (1 + 10%)^2 = 24,793.4440,000 / (1 + 10%)^3 = 31,190.

0450,000 / (1 + 10%)^4 = 36,658.59NPV = 18,182.81 + 24,793.44 + 31,190.

04 + 36,658.59 - 100,000 = 10,824.88 Project B's NPV

As a result, Project B is more attractive to a company that can raise an unlimited amount of money. For a company that is constrained in the funds it can raise, the project with the highest PI is the most appealing. As a result, Project B is more appealing to a company that is constrained in the funds it can raise.

To know more about Present visit:

https://brainly.com/question/1158528

#SPJ11

Irue or False: 1. All points inside a consumer's budget line are unaffordable. 2. The principal of diminishing marginal utility means that as consumption of a good increases, total utility increases but at a decreasing rate. 3. A household is maximizing utility if the marginal utility is equal for all goods and all its income is spent. 4. If the marginal utilities from consuming two goods are not equal, the consumer cannot be in equilibrium. 5. If the marginal utility per dollar spent on good X exceeds the marginal utility per dollar spent on good Y, total utility will increase by increasing the consumption of X and decreasing consumption of Y. 6. When the price of good X rises, the marginal utility from the consumption of X decreases. 7. When income decreases, the marginal utility derived from a good will always increase. 8. A demand curve describes the quantity demanded at each price when marginal utility is maximized.

Answers

False: All points inside a consumer's budget line are affordable. All points inside a consumer's budget line are affordable, while all points outside the budget line are unaffordable.

True: The principle of diminishing marginal utility states that as a person consumes more and more of a good, the total utility gained from each additional unit of the good will decrease. This means that the marginal utility decreases as the quantity consumed increases.

To know more about budget visit:

https://brainly.com/question/31952035

#SPJ11

1. Determine the manufacturing overhead cost per unit of each of the company's two products under the traditional costing system. 2. Determine the manufacturing overhead cost per unit of each of the company's two products under activity-based costing system.

Answers

In order to determine the manufacturing overhead cost per unit of each of the company's two products, we use traditional costing system and the activity-based costing system.

Traditional Costing System:

Under the traditional costing system, manufacturing overhead costs are allocated to products based on a predetermined overhead rate. This rate is usually calculated by dividing the total estimated manufacturing overhead costs by a selected cost driver, such as direct labor hours or machine hours.

To calculate the manufacturing overhead cost per unit using the traditional costing system, you'll need the following information:

Total estimated manufacturing overhead costs: This includes all indirect costs incurred in the production process, such as factory rent, utilities, maintenance, and indirect labor.

Cost driver: The selected cost driver used to allocate the overhead costs. For this example, let's assume the cost driver is direct labor hours.Direct labor hours per unit: The number of direct labor hours required to produce one unit of each product.

Once you have this information, you can use the following formula to calculate the manufacturing overhead cost per unit:

Manufacturing Overhead Cost per Unit = (Total Estimated Manufacturing Overhead Costs) / (Total Direct Labor Hours) * (Direct Labor Hours per Unit)

Activity-Based Costing System:

Activity-based costing (ABC) is a more refined costing method that allocates manufacturing overhead costs based on the activities that drive those costs. It identifies various cost pools and assigns costs to products based on their consumption of the activities.

To determine the manufacturing overhead cost per unit using activity-based costing, you'll need the following information:

Total costs for each activity: Identify the various activities involved in the production process, such as machine setup, material handling, quality control, and packaging. Determine the total costs associated with each activity.Cost driver rates: Calculate the cost driver rates for each activity by dividing the total costs of the activity by the total quantity of the cost driver. The cost driver can be different for each activity. For example, machine setup costs can be driven by the number of setups, while material handling costs can be driven by the number of pounds of material handled.Activity consumption per unit: Determine the consumption of each activity for each unit of the product. For example, if one unit requires 2 machine setups and 5 pounds of material handling, these would be the activity consumption values.

Using this information, you can calculate the manufacturing overhead cost per unit under the activity-based costing system using the following formula:

Manufacturing Overhead Cost per Unit = ∑(Activity Cost Driver Rate * Activity Consumption per Unit)

Please note that the specific values and calculations may vary depending on the details of your company's costing system, cost drivers, and activity structure. The above explanation provides a general framework for determining manufacturing overhead costs per unit under traditional costing and activity-based costing systems.

Learn more about Overhead cost:

brainly.com/question/13037939

#SPJ11

7-1 Project Two: Comparison Analysis
Scenario
the choice of business in Module Two journal assignment. Imagine as an analyst for that business, Disney World. The board of directors wants updates on the business's financial health. The supervisor has asked of you to write a report that includes the following:
The business's current financial health
The available financial options for improving the business
The recommendations about which options will support the business's financial health
The supervisor will present the report to the business's board of directors. The board members have different levels of knowledge about finance. You must write the report so it is easy for all board members to understand.
Directions
Create a report for the supervisor to share with the board of directors during their presentation. Use the Project Two Financial Assumptions document for descriptions of the three financial options you will evaluate. Use the business that was chosen from the Project Two Business Options List. Use the Mergent Online to find the company's most recent quarterly financial statements. Use these statements to support your analysis during the project. Use the Project Two Financial Analysis Report template to complete this project.
Financial Analysis: For this section, calculate the financial formulas listed in Part A. Use the most recent quarterly financial statements from your chosen business and the Project Two Financial Formulas worksheet.
Financial Calculations: Accurately calculate financial formulas to determine the business's current financial health. It would help if you calculated the following:
Working capital
Current ratio
Debt ratio
Earnings per share
Price/earnings ratio
Total asset turnover ratio
Financial leverage
Net profit margin
Return on assets
Return on equity
Working Capital Management: Explain the impact of working capital management on the business's operations. Provide examples to support the claims.
Financing: Explain how a business finances its operations and expansion.
Short-Term Financing: Explain how potential short-term financing sources could help the business raise funds for improving its financial health. Base any response on the business's current financial information.
Bond Investment: Discuss the risks and benefits of the business investing in a corporate bond. Include the necessary ethical factors, appropriate calculations, and examples to support the analysis. Use the Project Two Financial Assumptions document and the Bonds section of the Present Net Value (NPV) worksheet in the Project Two Financial Formulas workbook.
Capital Equipment: Discuss the risks and benefits of the business investing in capital equipment. Include the necessary ethical factors, appropriate calculations, and examples to support the analysis.
Capital Lease for Building: Discuss the risks and benefits of a business purchasing a capital lease. Include the necessary ethical factors, appropriate calculations, and examples to support your analysis. Use the Project Two Financial Assumptions document and the Building section of the NPV worksheet in the Project Two Financial Formulas workbook.
Financial Evaluation: In this section of the report, you will explain financing. You will also evaluate which of the three available finance options is the best.
Bond Investment: Determine if the bond investment is a good financing option for the business's financial health. Use your financial analysis and other financial information to your support claims.
Capital Equipment: Determine if the capital equipment investment is a good financing option for the business's financial health. Use your financial analysis and other financial information to support your claims.
Capital Lease for Building: Determine if the capital lease building purchase is a good financing option for the business's financial health. Use your financial analysis and other financial information to support your claims.
Future Financial Considerations: Describe the business's likely future financial performance. Base your description on the business's current financial well-being and risk levels. Use financial information to support your claims.

Answers

Disney World is a business with a stable financial health. The financial formulas calculated were Working capital, Current ratio, Debt ratio, Earnings per share, Price/earnings ratio, Total asset turnover ratio, Financial leverage, Net profit margin, Return on assets, and Return on equity.

Disney World finances its operations and expansions using Short-Term Financing, and the report has analyzed how potential short-term financing sources could help the business raise funds for improving its financial health.  Additionally, the report has discussed the risks and benefits of the business investing in capital equipment and the risks and benefits of a business purchasing a capital lease.

After analyzing the three available finance options, it has been recommended that Disney World should go with short-term financing because of its current financial state. Based on the current financial well-being and risk levels, the report has described the business's likely future financial performance, indicating that the business is likely to continue experiencing stable financial health in the future.

To know more about Return on assets visit:

https://brainly.com/question/31080458

#SPJ11

Use numbers to fill in blanks for total return definition is
-25%
33.33%
percentage increase
percentage decrease
final balance
7000
15000
20000
3years
5years
14.69years
The total return of the investment is____ It represents the_______ of the_________ The friend's investment grew from______to________ over__________

Answers

The total return of the investment is 33.33%. It represents the percentage increase of the final balance. The friend's investment grew from $7,000 to $15,000 over 3 years.

Total return is a measure used to evaluate the performance of an investment. It represents the overall gain or loss incurred on the initial investment, expressed as a percentage.

In this case, the total return is 33.33%, indicating a positive growth in the investment.

The percentage increase signifies the extent of growth in the investment value. It shows how much the investment has grown in relation to its initial value. In this scenario, the investment increased by 33.33% over the specified time period.

The final balance refers to the ending value of the investment after accounting for any gains or losses. In this case, the friend's investment grew from $7,000 to $15,000, indicating a significant increase in value.

Over the course of 3 years, the friend's investment experienced substantial growth, resulting in a total return of 33.33%. This performance suggests a successful investment strategy, outperforming many other investment options during that period.

For more such questions investment,Click on

https://brainly.com/question/29547577

#SPJ8

As the change leader, it is your responsibility to help ensure a successful change in the shift of DPC's organizational culture. Part of this includes alerting leadership to how their own behavior impacts change and how change can be sustainable.
Conduct academic research and create a plan to present to the CEO and board in which you complete the following successful change management plan:
Provides a thorough explanation of behaviors leaders do that impacts organizational change. Includes detailed alignment to organizational culture change.
Provides a thorough description of critical factors that ensures this cultural shift will be sustainable. Includes detailed alignment to organizational culture change.
Provides thorough examination of the top mistakes leaders make during a change. Includes detailed alignment to organizational culture change.
Provides a thorough explanation of recommendations for leaders to avoid making mistakes during an organizational change

Answers

Successful Change Management Plan for DPC’s Organizational Culture ShiftAs a change leader, the responsibility for a successful shift of DPC’s organizational culture falls on you. To ensure a sustainable change, you need to present a plan to the CEO and board of DPC.

This plan includes behaviors leaders should exhibit or avoid exhibiting during the change process, critical factors to sustain a cultural shift, and recommendations for leaders to avoid common mistakes during the change process.Behaviors Leaders Should Exhibit or Avoid Exhibiting During the Change ProcessTo ensure a successful change process, leaders should be conscious of their behaviors that may impede the change process.

One of the first behaviors leaders should exhibit is to be open-minded and flexible. This behavior would help them to embrace change instead of resisting it. In addition, leaders should communicate effectively with stakeholders to gain their buy-in and commitment. Leaders should also create a culture of trust by being honest and transparent. On the other hand, leaders should avoid micromanaging employees, which could demotivate and demoralize employees.

Leaders should also avoid resisting change, which could send a negative message to employees.Critical Factors to Ensure This Cultural Shift Will Be SustainableTo ensure a sustainable cultural shift, the organization needs to consider some critical factors. First, the organization needs to establish a clear vision, mission, and strategy for the change. This vision should be communicated effectively to all employees to gain their commitment and support.

Second, the organization needs to align its structure, policies, and processes to the new culture. This alignment would make the new culture a part of the organization’s DNA. Third, the organization needs to develop its employees to ensure they have the necessary skills and competencies to thrive in the new culture. This development would help them to adapt to the new culture quickly.

To know more about Management visit:

https://brainly.com/question/32216947

#SPJ11

On January 1, 2021, Empresas Morosas issued bonds payable for a par value of $3,400,000. The bonds mature in 20 years. The interest rate on the contract is 9% payable semi-annually on 30 June and 31 December. As the market rate of similar bonds is at 8%, the bonds were sold at a premium at 102% of their maturity value (par value).
1. Make the daily entry to record the first interest payment on June 30, 2021 assuming that the premium is amortized by the straight line method. Remember that you must compute the premium first.

Answers

On January 1, 2021, Empresas Morosas issued bonds payable for a par value of $3,400,000. The bonds mature in 20 years. The interest rate on the contract is 9% payable semi-annually on 30 June and 31 December. As the market rate of similar bonds is at 8%, the bonds were sold at a premium at 102% of their maturity value (par value).

Journal entries are used to record transactions on a company's financial statements. These transactions are posted to accounts in a journal entry in order to keep a chronological record of the transactions. For each transaction, debits and credits must be equal.1. To determine the bond's premium, we must first compute the present value of the bond's interest and principal payments.

The present value of the bond's interest and principal payments is $4,146,621. Bond Premium is $746,621 ($4,146,621-$3,400,000).2. Bond Premium can be amortized using the straight-line method by dividing the bond premium by the bond's total interest payments.

Bond Premium Amortized is $18,731 per interest period ($746,621/40).3. The journal entry for the first semi-annual interest payment of $153,000 on June 30, 2021, with bond premium amortized by the straight-line method, would be as follows:DateAccountTitleDebitCredit30-JunInterest expense149,269 Premium on bonds.

payable4,731Cash153,000(To record semi-annual interest payment) Therefore, the journal entry to record the first interest payment on June 30, 2021, assuming that the premium is amortized by the straight-line method is:DateAccountTitlesDebitCredit30-JunInterest Expense (9% of $3,400,000) 153,000Bond Premium Amortization 18,731Cash 153,000Bond Premium on Payable 4,731 Interest Payable 149,269(To record semi-annual interest payment on bond payable)

To know more about  semi-annually visit:

https://brainly.com/question/30281123

#SPJ11

Imagine you are the CEO of a large company how would you build a better organization? Identify at least two areas and highlight specific practices you would implement to "build a better organization."
Suppose you are a manager; identify two ways you could connect performance appraisal to organizational goals in your company. Please be specific.
Do you believe that there is a problem with performance appraisal or performance management?

Answers

As the CEO of a large company, there are several areas to concentrate on to create a better organization.

In this regard, the following are two of the most critical areas of focus:

Communication

To build a better organization, communication is key.

It is vital to make sure that employees are aware of the company's mission, vision, and objectives.

Furthermore, it is essential to keep them informed of any changes or developments that could impact their work or the organization.

as the CEO, it is important to establish clear channels of communication with all employees, from top-level executives to entry-level staff.

This can be done through regular company-wide meetings, email newsletters, or a company intranet.

Moreover, the CEO should encourage and foster an open-door policy in which employees can share their thoughts and ideas.

This can be achieved by scheduling regular town hall meetings where employees can provide feedback and ask questions.

Employee Engagement

Creating a positive and engaging workplace culture is another critical area to focus on as a CEO.

Employee engagement can be defined as the extent to which employees are committed to their work and the organization.

To achieve this, the CEO must first establish a work environment that fosters respect, collaboration, and teamwork.

One way to do this is to create cross-functional teams that work together to accomplish organizational goals.

Additionally, the CEO should provide opportunities for employee development and growth.

This can be achieved by offering training and development programs that are tailored to individual employee needs.

As a manager, two ways to connect performance appraisal to organizational goals are as follows:

As such, many organizations are re-evaluating their performance appraisal systems and looking for alternative approaches that are fair,

objective, and more closely aligned with organizational goals.

To know more about concentrate visit:

https://brainly.com/question/13872928

#SPJ11

Question 1 (Marks: 15) Cape Union Mart is one of the leading South African organisations targeting the outdoor enthusiast. Whether you are a hiker, camper or canoer, you are bound to find everything you need for your adventure here. Discuss why you believe the products sold by Cape Union Mart is a good example of an exportable product.

Answers

Cape Union Mart is an organisation based in South Africa that targets outdoor enthusiasts. If you're an individual who enjoys hiking, camping, or canoeing, you can find all of your adventure equipment at Cape Union Mart.

Exportable products are those that can be produced in one country and sold in another. It means that the goods or services can be traded across international borders without violating any customs or tariffs. Quality is crucial to the export market because people are willing to pay for goods that last longer, perform better, and are reliable.

As a result, these products are likely to attract customers from other countries, as they may not be able to purchase similar products from their home country.In conclusion, the products sold by Cape Union Mart are an excellent example of exportable products because they are high-quality, reasonably priced, and unique to the South African market.

To know more about enthusiasts visit:

https://brainly.com/question/32687918

#SPJ11

once a consumer completes their shopping experience, the marginal utility per dollar of each item purchased is closer in value than when they began shopping.

Answers

This statement refers to the concept of diminishing marginal utility. Marginal utility is the additional satisfaction or benefit that a consumer derives from consuming an additional unit of a good or service.

According to the law of diminishing marginal utility, as a consumer consumes more of a particular good, the marginal utility derived from each additional unit decreases.When a consumer starts their shopping experience, they usually have a variety of needs and desires that they aim to fulfill. They have a wide range of options to choose from, and each item they purchase provides them with a certain level of satisfaction or utility.As the consumer continues shopping and purchases more items, the marginal utility of each additional item tends to decrease. This means that the satisfaction or benefit derived from each additional purchase becomes less significant compared to the earlier purchases. In other words, the consumer becomes less willing to pay a higher price for each additional item.

For example, let's say a consumer goes to a clothing store with the intention of buying a new outfit. Initially, they may buy a pair of jeans, a shirt, and a jacket. Each of these purchases brings them a certain level of satisfaction, and the marginal utility per dollar spent on each item is relatively high.However, as they continue shopping, they might decide to buy additional items like socks, a belt, or accessories. At this point, the consumer's marginal utility per dollar spent on each item decreases because they have already fulfilled their primary needs and desires with the earlier purchases. The satisfaction they derive from these additional items is lower compared to the initial purchases.

To know more about consumer visit:
https://brainly.com/question/32959474

#SPJ11


Reward Strategy should be dictated by business imperatives and
legacy of the past. Discuss in 3000 words.

Answers

Reward strategy is an integral part of any organization, and it can significantly impact the performance of a company. An efficient reward strategy is one that aligns with the company's objectives and goals. This essay aims to discuss how reward strategy should be dictated by business imperatives and legacy of the past.

Business imperatives refer to the business goals and objectives of the organization. An effective reward strategy should be aligned with the business imperatives of the company to motivate and retain employees. A reward strategy that does not align with business imperatives can have adverse effects on employee performance and engagement.
Legacy of the past refers to the history of the company's reward system. Similarly, a company that has had issues with employee retention should consider developing a new reward strategy that addresses these issues.

When developing a reward strategy, it is essential to take into account the various factors that affect employee motivation. Some of these factors include salary, bonuses, benefits, and work-life balance. An effective reward strategy should be balanced and considerate of the different needs of employees. Furthermore, a reward strategy should consider the company's culture and values. The reward system should align with the company's values to ensure that the employees' actions and behaviors are consistent with the company's culture.

To know more about motivate visit:

https://brainly.com/question/31576376

#SPJ11

Determine the ending Capital balance of a business having: Beginning Capital of $40,000 No investments or withdrawals Inventory of $10,000 Cost of Goods Sold of $90,000 Prepaid Insurance of $12,000 Operating expenses of $72,000 Net sales $180,000

Answers

The ending capital balance of a business is determined by subtracting the sum of the business's expenses and cost of goods sold from the net sales and adding the difference to the beginning capital balance.

The formula for calculating the ending capital balance of a business is given below:

Ending Capital Balance = Beginning Capital Balance + Net Sales – Cost of Goods Sold – ExpensesThe beginning capital of the business is given as $40,000. The inventory is $10,000, and the cost of goods sold is $90,000.

To know more about capital visit:

https://brainly.com/question/32408251

#SPJ11

duration, and any predecessor tasks. Be careful to create a thorough, comprehensive document. Little content = little points.

Answers

When creating a comprehensive project plan, it is important to consider the duration of each task as well as any predecessor tasks. The main answer lies in ensuring that the project plan includes all necessary tasks and timelines for successful completion.

To create a comprehensive project plan, start by breaking down the project into smaller tasks and identifying any dependencies or predecessor tasks that must be completed before others can begin. This will help to ensure that the project flows smoothly and that all necessary tasks are completed in the proper sequence.

Next, assign a duration to each task. This should be based on realistic estimates of the amount of time it will take to complete each task, taking into account any potential obstacles or delays that may arise. Be sure to include some buffer time to account for unforeseen circumstances.

Finally, create a timeline that includes all of the tasks and their durations, as well as any dependencies or predecessor tasks. This will give you a clear roadmap for completing the project and help you to identify any potential bottlenecks or roadblocks that may need to be addressed.

Overall, a comprehensive project plan should be detailed enough to provide a clear picture of the project and its timeline, while also being flexible enough to accommodate changes or adjustments as needed. By taking the time to create a thorough project plan, you can increase the likelihood of success and ensure that all team members are working towards the same goals.

Learn more about comprehensive project plan: https://brainly.com/question/31821400

#SPJ11

In its first month of operation, Kingbird Company purchased 80 units of inventory for $6, then 160 units for $7, and finally 112 units for $8. At the end of the month, 144 units remained. The company uses the periodic method. Compute the amount of phantom profit that would result if the company used FIFO rather than LIFO. Phantom profit \$

Answers

The amount of phantom profit that would result if the company used FIFO instead of LIFO

To compute the amount of phantom profit that would result if the company used FIFO (First-In, First-Out) rather than LIFO (Last-In, First-Out), we need to compare the cost of goods sold (COGS) under both methods.

Given:

Inventory purchases:

80 units at $6 per unit

160 units at $7 per unit

112 units at $8 per unit

Ending inventory: 144 units

Using the periodic method, let's calculate the COGS under LIFO:

Step 1: Calculate the cost of goods sold (COGS) using LIFO.

LIFO assumes that the most recent purchases are sold first.

COGS = (80 units x $8 per unit) + (160 units x $7 per unit) + (144 units x $6 per unit)

COGS = $640 + $1,120 + $864

COGS = $2,624

Step 2: Calculate the COGS under FIFO.

FIFO assumes that the oldest purchases are sold first.

To calculate the COGS under FIFO, we need to allocate the cost of the remaining inventory to the COGS.

Number of units sold = 80 units + 160 units + 112 units - 144 units

Number of units sold = 208 units

COGS = (80 units x $6 per unit) + (160 units x $7 per unit) + (48 units x $8 per unit)

COGS = $480 + $1,120 + $384

COGS = $1,984

Step 3: Calculate the difference in COGS between LIFO and FIFO.

Phantom profit = COGS under FIFO - COGS under LIFO

Phantom profit = $1,984 - $2,624

Phantom profit = -$640

Learn more about  Calculate  here:

https://brainly.com/question/27846658

#SPJ11

In calculating GDP:

a) both exports and imports are added

b) neither exports nor imports are added

c) exports are added and imports are subtracted

d) imports are added and exports are subtracted

Answers

In calculating GDP, (c) exports are added and imports are subtracted.

1. Gross Domestic Product (GDP) is a measure of the total value of all goods and services produced within a country's borders during a specific period, typically a year.

2. When calculating GDP, exports and imports play a crucial role in determining the final value.

3. Option a) states that both exports and imports are added to GDP. However, this is incorrect because adding both would result in double-counting the value of goods and services.

4. Option b) suggests that neither exports nor imports are added to GDP. This is also incorrect because both exports and imports contribute to the overall economic activity of a country.

5. Option c) states that exports are added and imports are subtracted from GDP. This is the correct approach. Adding exports captures the value of goods and services produced domestically but consumed abroad. On the other hand, subtracting imports accounts for goods and services consumed domestically but produced abroad.

6. Option d) suggests that imports are added and exports are subtracted from GDP. This is the opposite of the correct approach. Adding imports would result in counting the value of goods and services produced abroad, while subtracting exports would mean excluding the value of goods and services produced domestically but consumed abroad.

7. Therefore, the correct answer is c) exports are added and imports are subtracted when calculating GDP. This method ensures an accurate representation of a country's domestic production and economic activity.

Thus, the correct option is c.

For more such questions on GDP, click on:

https://brainly.com/question/30109070

#SPJ8

The Central Bank mandates a "reserve ratio" of \( 1.25 \% \). A commercial bank receives a new deposit of \( \$ 2,000 \) from a customer who had it stored under their mattress for years. If the commer

Answers

The Central Bank requires commercial banks to have a "reserve ratio" of 1.25 percent. When a commercial bank receives a new deposit of $2,000 from a client who has had it under their mattress for years.

The reserve ratio, also known as the reserve requirement, is the amount of money that commercial banks must keep in reserve with the Central Bank. It is an essential tool for controlling the country's money supply, which affects the economy's overall health. The Central Bank mandates this requirement because it wants to make sure that banks have enough money in reserve to meet their financial obligations to their clients if necessary.

Now, let's see how the Central Bank's mandated reserve ratio of 1.25 percent relates to the $2,000 deposit from the customer. The bank will hold a portion of this deposit in reserve, as per the Central Bank's requirements. It will lend out the remainder of the money to make a profit on interest. Since the reserve ratio is 1.25 percent, the bank must keep 1.25 percent of the deposit in reserve and lend out the remaining 98.75 percent.

To know more about mandates visit:

https://brainly.com/question/32096171

#SPJ11

Which of the following is classified in the most persuasive evidence of government control?
A. Government has the power to establish or amend the policies that the organization uses to manage, such as those relating to accounting, personnel, compensation, collective bargaining or deployment of resources.
B. Government has the power to approve the business plans or budgets for the organization and require amendments, either on a net or line-by-line basis.
C. Government has the power to provide significant input into the appointment of members of the governing body of the organization by appointing a majority of those members from a list of nominees provided by others or being otherwise involved in the appointment or removal of a significant number of members.
D. Government has the unilateral power to dissolve the organization and thereby access its assets and become responsible for its obligations

Answers

The claim that option D, which reads, "Government has the unilateral power to dissolve the organisation and thereby access its assets and become responsible for its obligations.

The one that is deemed to be the most convincing proof of government control among the possibilities is, "Government has the unilateral power to dissolve the organisation and thus access its assets and become responsible for its obligations."This claim underlines the degree to which the government has major control over the organisation. The ability to dissolve an organisation indicates that the government has the capacity to do so, as well as to take over its assets and obligations and put an end to the organization's existence. Given that they have the power to decide the organization's future, this shows a significant amount of influence and control on the part of the government.

learn more about organisation here :

https://brainly.com/question/32971125

#SPJ11

Environmental Cost Report Verde Company reported operating costs of $58,000,000 as of December 31,20×5, with the following environmental costs:

Answers

Verde Company incurred $58 million in direct environmental costs as of December 31, 2015, showcasing their commitment to sustainability and compliance.

As of December 31, 2015, Verde Company had incurred environmental costs totaling $58,000,000. These charges fall under the category of direct costs associated with conservation and environmental protection initiatives. Investments in waste management systems, pollution control technology, and cleanup efforts are a few examples of these costs. Verde Company exhibits a commitment to sustainability and ethical business practices by dedicating a sizeable amount of their operating budget toward these environmental costs. By making these investments, the company hopes to reduce its environmental impact, reduce environmental hazards, and make sure that it complies with all applicable laws. The proactive strategy used by Verde Company demonstrates their commitment to striking a balance between environmental care and economic success.

Learn more about  environmental costs here:

https://brainly.com/question/28249565

#SPJ11

All resources are fixed in the short run. 2. Given a fixed quantity of capital, if 2 additional labourers produce 15 additional units of output, then marginal product of labour is 15 units of output. 3. The law of diminishing marginal returns implies that eventually the marginal product curve will be negatively sloped as the variable input increases. 4. Marginal product is measured by the slope of the total product curve. 5. If the marginal product of labour is greater than the average product of labour, average product is increasing. 6. Average variable cost reaches its minimum at the same level of output at which marginal product is at maximum. 7. If average variable cost is decreasing, then marginal cost must be decreasing. 8. The average total cost curve always intersects the minimum point of the marginal cost curve. 9. Economies of scale means that the long run average cost curve is positively sloped. 10. Minimum efficient scale occurs at the minimum point of average total cost curve.

Answers

The given statement “All resources are fixed in the short run” explains that in the short run, a firm cannot change the quantities of certain inputs. it can alter the quantity of other inputs, given a fixed quantity of the fixed inputs.

The key terms of the statement include a fixed quantity of capital, additional laborers, marginal product of labor, and the law of diminishing marginal returns. According to the law of diminishing marginal returns, the marginal product curve would eventually be negatively sloped as the variable input increases.

The marginal product measures the additional output produced when one more unit of input is employed while keeping other inputs constant. Marginal product is also measured by the slope of the total product curve. If the marginal product of labor is greater than the average product of labor, then the average product is increasing.

To know more about resources visit:

https://brainly.com/question/14289367

#SPJ11

Other Questions
Which of the following names is correct according to IUPAC? A. 1,1-dimethylhexane B. 1,2-dimethylcyclohexane C. 1,2-dimethylhexane D.2,3-dimethylcyclohexane Use the Product Rule to evaluate and simplify d/dx((x-3)(4x+2)). Write the function getkthdigit(n, k) that takes a possibly-negative int n and a non-negative int k, and returns the kth digit of n, starting from 0, counting from the right a group of 95 students were surveyed about the courses they were taking at their college with the following results: 57 students said they were taking math. 57 students said they were taking english. 62 students said they were taking history. 32 students said they were taking math and english. 39 students said they were taking math and history. 36 students said they were taking english and history. 19 students said they were taking all three courses. how many students took none of the courses? 4. (30 points) load data file. the first column is the recorded time and the second column is the recorded distance of a ball. use a for loop to compute velocity from the altitude data using forward differences. (b) modify your code to calculate the velocity without using a loop. (c) your script should also plot the computed velocity as a function of time. which of the following did not challenge the mass conformity of the 1950s logistics is the ____ and storage of material inventories throughout the supply chain so that everything is in the right place at the right time. Required a. The ledger is already set up for you based on the chart of accounts. b. Journalize (all page 1) and post the April transactions. c. Prepare a trial balance as of April 30, 2023. The chart of accounts includes Cash, 111; Accounts Receivable, 112; Prepaid Rent, 114; Art Supplies, 121; Equipment, 131; Accounts Payable, 211; Beth Orth Capital, 311; Beth Orth, Withdrawals, 312; Art Fees Earned, 411; Electrical Expense, 511; Salaries Expense, 521; Telephone Expense, 531. A study by the television industry has determined that the average sports fan watches 10 hours per week watching sports on TV with a standard deviation of 3.3 hours. Vancouver TV is considering establishing a specialty sports channel and takes a random sample of 36 sports fans.(a) Describe the shape of the sample mean distribution. Circle the correct one: [2 marks]A. Normally distributed because sample size bigger than 30B. Cannot be determined because sample size is bigger than 30C. Cannot be determined because the population distribution is unknownD. Normally distributed because the population distribution is unknown(b) What is the mean and standard deviation of the sample means? [5 marks) From the following list, select a job/career, and, using internet and other sources, explain how that job/career either actually has a marketing function and/or activities, or is dependent on others who do perform marketing tasks and activities.AccountantBallerinaBaseball playerCar Mechanic at Wal-MartConstruction CarpenterDirector of local Salvation Army Men's Rescue ShelterElephant keeper at City ZooResearch ScientistState Social WorkerUS Senator you are called for an ill person. upon your arrival, the patient is complaining of numbness to the perineum and back pain, and has evidence of urinary incontinence. you suspect: refer to figure 5-1. with reference to graph a, at a price of $10, total revenue equals:A" was at $10 and 40 so the answer is $400 tra Credit] The function \( f:[0, \pi / 2] \rightarrow[-1,1] ; f(x)=\cos (x) \) is: decreasing injective surjective none of these properties invertible increasing to keep the calculations fairly simple, but still reasonable, we shall model a human leg that is 92.0 cm long (measured from the hip joint) by assuming that the upper leg and the lower leg (which includes the foot) have equal lengths and that each of them is uniform. for a 70.0 kg person, the mass of the upper leg would be 8.60 kg , while that of the lower leg (including the foot) would be 5.25 kg . the most common model for families with children in contemporary u.s. society is lead-208 is bombarded with a zinc-70 nucleus to produce another nuclide and one neutron. what nuclide forms? A petroleum company has a shipment that based on the nature of the goods they arrived in a tanker container at the Sufferance Wharf of the company and in a regular 20 container on the premises of the company due to its Site Inspection privileges. Unleaded gasoline and Sparkling Wine (for the company party) are being imported. The tanker container contains 150,000,000 millilitre of unleaded gasoline 87. The Import Duty (ID) rate is 10% and similarly the Special Consumption Tax Advalorem (SCTA) rate is 10%. The Special Consumption Tax Specific (SCTS) is $38.1492 JMD per litre. The 20 container with the Sparkling Wines has 2 layers of 10 pallets with each pallet containing 8 boxes of 12 bottles with 750 millilitres Sparkling Wine. Each bottles has an alcohol strength of 11.5%. The broker informs that, the Import Duty (ID) rate is 40%, the Additional Stamp Duty (ASD) rate is $1USD per litre and the Special Consumption Tax Specific (SCTS) is $1230.00 JMD of pure alcohol of the total volume. The invoice value for Sparkling Wine is $18,000.00USD. The freight for the shipment is $5000.00 USD. The company is exempted from paying GCT for gasoline imported based on the Petroleum Act. Given that: The invoice cost gasoline is $500,000.00 USD General Consumption Tax (GCT) rate is 20% Customs Administration Fee (CAF) is $3.50 JMD per litre for gasoline and $15,000.00 JMD for sparkling wine Standard Compliance Fee (SCF) rate is 0.3% Environmental Levy (ENVL) rate is 0.5% Stamp Duty is $5000.00 JMD Exchange ratio is 1USD: 135 JMD Calculate all duties, taxes and fees payable and the total sum payable by your client for this shipment You are excited to try your first CRISPR experiment. You introduce Cas9 and one sgRNA into a dish of cultured human cells. You then sequence DNA from four different cells and obtain the results of sequences 1-4 below.Which sgRNA sequence will target Cas9 to generate the gene editing results shown below?a) 3' AGATCGTTAGCAGAAACAAA 5'b) 3' TCTAGCAATCGTCTTTGTTT 5'c) 5' AGATCGTTAGCAGAAACAAA 3'd) 5' TCTAGCAATCGTCTTTGTTT 3 cani get some help please15. Describe the use of cofactors in the conversion of apoenzymes to holoenzymes. Convert the following temperatures from Fahrenhed to Celsius or vice versa. C= 1.8F32,F=1.8C+32 a. 55 F b. 50 C c. 15 C a. 55 F=C (Type an integer or decimal rounded to orie decimal piace as needed) b. 50 C= if (Type an integer or decimal rounded to one decimal place as needed.) c. 15 C=F (Type an inseger of decimal rounded to one decimal place as needed.)