The cane toad became a pest after it was brought to Australia to control destructive insects in Queensland's sugar cane crops.
Cane toads can poison predators who try to eat them, and they continue to spread across Australia. The giant toad couldn't crush the beetle population, but it did manage to multiply it dramatically. Due to their highly toxic skin covered with bufotoxin, they have no natural predators and have invaded much of the north and east of the country.
It has taken root in more than 15 countries over the past 150 years. In the Environmental Protection and Biodiversity Conservation Act 1999, the Australian Government lists cane toad impacts as a major threat process. Healthy libido and a deadly hidden chemical defense system have made them one of the top 100 most invasive species on the planet.
Learn more about The cane toad here:- https://brainly.com/question/1479068
#SPJ4
Gal80 is mutated such that it cannot interact with gal3. What effect on transcription would you expect to see in the presence of galactose?.
Transcription is blocked in the presence of galactose .
Galactose performs activities by inhibiting the negative regulator GAL80, while glucose, is responsible for antagonizing GAL4 function by several mechanisms. When galactose is absent, Gal80 binds and inhibits the transcriptional activation domain (AD) of the GAL gene activator, Gal4, preventing GAL gene expression.
Saccharomyces cerevisiae GAL80 gene is a negative regulator of the Saccharomyces cerevisiae GAL4 transcriptional activator. A dimer of GAL80 binds to a GAL4 dimer, GAL4 when binds to UAS sequence it will stop transcription.
To learn more about Transcription , here
brainly.com/question/14136689
#SPJ4
pseudopods are unique structures that belong to... group of answer choices sporozoa ciliophora amebozoa mastigophora
The correct answer is c. Amoebozoa
Unique structures called pseudopods belong to Amoebozoa.
Protists that are unique among amoebozoans are those that have pseudopods. Pseudopods are transient, cell membrane-based protrusions that serve as means of propulsion and/or feeding. A notable characteristic of an Amoeba's movement is that it resembles crawling. Pseudopods are formed by the cell near the front.
An Amoeba's cytoplasm is made up of plasmasol and is encircled by a more viscous plasma gel. The cytoplasm slides and forms a pseudopodium in front as the plasma gel transforms into plasmasol, propelling the cell forward.
Amoeboid movement is the name for this type of movement. Amoebozoan cells can be separated into two layers of cytoplasm: ectoplasm and endoplasm. The ectoplasm is the transparent outer layer of the cytoplasm, whereas the endoplasm is a granular inner bulk.
To learn more about Amoeba do visit-
https://brainly.com/question/8227
#SPJ4
which is the best definition of generation time? multiple choice 4 the time it takes for the number of cells in a population to double. the 24 hours it takes for cells to achieve maximum growth rate. the time it takes for a bacterial cell to complete one round of mitosis. the time it takes for a bacterial cell to duplicate its dna. the time it takes it takes for a bacterial population to exponentially decrease.
The time it takes for the number of cells in a population to double is called Generation time.
The generation time measures how long it takes a bacterium under ideal conditions to produce two daughter cells. The generation time of the majority of medically relevant bacteria is 20 minutes. Some might even need more time—18 to 24 hours.The amount of time it takes for a colony of bacteria to double in size is known as the generation time. The generation time for various bacteria ranges from a few minutes to several hours. Bacteria multiply through geometric progression—their population doubles every generation—thanks to binary fission.The generation time of an organism varies greatly among species and plays a significant role in the life cycle, life history, and evolution of that species.To know more about Generation time check the below link:
https://brainly.in/question/453837
#SPJ4
The genetic code consists of ____ codons that specify amino acids, and ____ codons that do not specify amino acids.
The genetic code is made up of 3 codons that do not identify any amino acids and 61 codons that do.
The genetic code specifies how many amino acids.A, U, G, and C, the four nucleotides found in mRNA, can be combined in 64 different ways thanks to the codons' three-letter structure. 64 codons are present; 61 of them correspond to amino acids, and the final three to stop signals that mark the end of protein synthesis.
Three of the 64 potential codons do not code for amino acids but rather signal the end of a protein instead. The 61 codons that remain describe the 20 amino acids that go into proteins. The beginning of the DNA contains the AUG codon, which codes for methionine in addition of each mRNA and signifies the beginning of a protein.
To know more about genetic code visit:-
https://brainly.com/question/21272924
#SPJ4
Do you think risk assessment would be a better strategy for a prey animal than frequent vigilance? explain your reasoning.
In general, risk assessment would be preferable than constant vigilance for a prey animal.
What are the tactics used by predators to capture their prey?Under the pressure of natural selection, predators have developed a variety of physical adaptations for locating, catching, killing, and digesting prey. These consist of swiftness, dexterity, stealth, keen senses, teeth, claws, filters, and adequate digestive systems.
What does animal behavior mean by vigilance?Animals that have evolved vigilance behaviors keep an eye out for potential hazards in their environment (Quenette, 1990; Treves, 2000; Beauchamp, 2015).
In general, risk assessment would be preferable than constant vigilance for a prey animal. The prey would be aware of their surroundings and search for signs of potential harm, such as the presence of a predator.
To know more about prey animal visit:-
https://brainly.com/question/813932
#SPJ4
predict the effect on short-term atp production when resveratrol-treated mammalian muscle cells are grown in a culture medium that lacks glucose or other sugars.
The impact of resveratrol treatment on mammalian muscle cells' short-term atp synthesis • No ATP synthesis; reduced ATP synthesis
The quantity of energy released during aerobic respiration is a significant benefit. Only two pyruvate molecules (ATP) can be produced from glucose by organisms in the absence of oxygen.In the presence of oxygen, organisms may convert glucose into carbon dioxide. The rate declines as the product to substrate ratio rises. Your respiratory and circulatory systems are unable to deliver oxygen to the muscle cells quickly enough to sustain aerobic respiration during these intervals. This is especially true for the muscles in your legs. Your muscle cells employ the lactic acid fermentation process to enable the ongoing generation of some ATP synthesis.
Learn more about ATP
https://brainly.com/question/14637256
#SPJ4
what components from the patella do not articulate with the femur in extension question 23 options: inferior 25% inferior 15% medial and lateral borders superior borders
The patella (kneecap) is situated in the patellofemoral groove of the femur, at the front of the knee joint. The patellar ligament is linked to its inferior side, and the quadriceps tendon to its superior side.
It is the largest sesamoid bone in the body and is categorized as a sesamoid type bone because of its location within the quadriceps tendon. This article will examine the patella's anatomy, including its surface characteristics, physiological purposes, and clinical applicability. Although partial patellar resection and internal fixing methods have been described, fractures near the base of the patella typically don't need surgery 76-78 Only if the quadriceps apparatus is completely disrupted (i.e., the stifle cannot be extended), the fracture gap is greater than 5 mm on radiographs, an articular fragment is obviously misaligned, or the fragments can be felt under the skin should surgery be tried.
Learn more about to patella visit here:
https://brainly.com/question/28891315
#SPJ4
What causes convection in the mantle quizlet?.
Internal heating from the decay of radioactive isotopes of uranium, thorium, and potassium, as well as long-term secular cooling of the earth and heat from the core, are the primary sources of thermal energy for mantle convection.
The movement of the mantle as it transfers heat from the white-hot core to the brittle lithosphere is described as mantle convection. The mantle is heated from below and cooled from above, and its overall temperature drops over time. All of these factors play a role in mantle convection.
Mantle convection is the slow creeping motion of the Earth's solid silicate mantle as convection currents transport heat from the interior to the planet's surface. The lithosphere of the Earth's surface sits on top of the asthenosphere, and the two make up the upper mantle. Hot rocks advect heat upward, while cold rocks advect cold downward; this counterflow is equivalent to an upward heat flux.
To learn more about convection in the mantle, here
https://brainly.com/question/12265809
#SPJ4
a person in an emergency situation is unable to eat for several weeks. which of the following would provide most of the energy that this person would need to survive? a. fat b. bones c. muscle glycogen d. blood glucose e. liver glycogen
Fat would provide most of the energy that this person would need to survive.
Why would fat provide most of the energy to survive?Lipids include а diverse group of compounds thаt аre united by а common feаture. Lipids аre hydrophobic, or insoluble in wаter, becаuse they аre nonpolаr molecules. This is becаuse they аre hydrocаrbons thаt include only nonpolаr cаrbon-cаrbon or cаrbon-hydrogen bonds. Lipids perform mаny different functions in а cells. Cells store energy for long-term use in the form of lipids cаlled fаts.
Fаt is the most cаlorie dense food аnd hаving а storаble, high cаlorie compаct energy source would be importаnt to survivаl.
For more information about fats refer to the link:
https://brainly.com/question/27084380
#SPJ4
please help with this question
which of these contain phytochemicals? question 14 options: a) tomatoes b) egg yolks c) fish d) all of the above
Phytochemicals are present in tomatoes.
Lycopene is a sort of phytochemical, right?One of the many colors found in plants known as carotenoids is lycopene. From the yellow color of squash to the orange color of pumpkins to the red color of tomatoes, carotenoids produce a variety of hues.
What phytochemical causes red tomatoes?Because the phytochemical lycopene is present, most tomatoes turn red when they are ripe (a biologically active compound produced by plants). They are rich in chlorophyll, a phytochemical that also contributes to the green color of young tomatoes.
How do phytochemicals work?Plants contain substances called phytochemicals.
Foods made from plants, such as fruits, vegetables, whole grains, nuts, seeds, and legumes, contain these compounds.
To know more about phytochemicals visit:-
https://brainly.com/question/13190380
#SPJ4
Which hormones help the body resist stress and make stored nutrients available to prepare the body for action?.
The hormone that helps the body resist stress and makes stored nutrients available to prepare the body for action would be Cortisol.
The main stress hormone, cortisol, elevates blood sugar (glucose), improves the brain's utilization of glucose, and increases the availability of substances that repair tissues. Furthermore, cortisol inhibits activities that, in a fight-or-flight scenario, would be unnecessary or harmful. Your kidneys' endocrine glands, the adrenal glands, produce and release the steroid hormone cortisol. Your body's response to stress is the primary aspect of cortisol's influence on your body.
Since it plays a role in how the body reacts to stress, cortisol is frequently referred to as the stress hormone. Blood pressure and immune responses are all increased, along with blood sugar and sugar levels. produced by the pituitary and hypothalamus in response to intense physical activity, excitement, and orgasm, and has analgesic properties.
Learn to know more about Stress on
https://brainly.com/question/18339187
#SPJ4
Why will the microbiota in the vagina of a woman of reproductive age differ from that of the same woman before puberty and after menopause?.
The vagina stores a large amount of glycogen during the reproductive years, which Lactobacillus acidophilus ferments to produce lactic acid and an acidic environment. Before and after menopause, glycogen is missing.
What affects the microbiome in the vagina?Age, ethnicity, and physiological elements including monthly hormone variations and the immune system all have an impact on the vaginal microbiota's extremely dynamic composition.
What creates the oil that skin-dwelling microorganisms enjoy living in?Sebaceous glands secrete the lipid-rich material known as sebum by joining with the hair follicle to form the pilosebaceous unit. Sebum is a hydrophobic coating that serves as an antibacterial barrier, lubricant, and shield for the skin and hair.
To know more about microbiome visit:-
https://brainly.com/question/28436387
#SPJ4
repair systems target a single kind of lesion in dna and repair only that damage, while repair systems use a single mechanism to repair multiple kinds of lesions in dna.
The sympathetic division of the ans is also called the thoracolumbar division as it arises from the thoracic and lumbar regions of the spinal cord.
What is the thoracolumbar division?The peripheral nervous system's autonomic nervous system controls physiological functions that are carried out automatically, such as digestion, blood pressure, respiration, and sexual desire.
The thoracolumbar division of the autonomic nervous system is the part of the body that is responsible for kicking off the "flight or fight" reaction when the body is under stress.
Therefore, The sympathetic division of the ans is also called the thoracolumbar division as it arises from the thoracic and lumbar regions of the spinal cord.
Learn more about thoracolumbar division on :
brainly.com/question/29507759
#SPJ1
The inheritance pattern of one gene will not affect the inheritance pattern of another gene. This is known as(1 point)
When the inheritance pattern of one gene will not affect the inheritance pattern of another gene it is known as independent assortment.
What is independent genetic assortment?Independent genetic assortment refers to two or more non-linked genes that are located on different chromosomes and therefore they segregate in an independent way, thereby inheritance patterns are not mutually affected.
Therefore, with this data, we can see that independent genetic assortment makes reference to the independent process of segregation of two or more genes that are located on loci on different pairs of homologous chromosomes.
Learn more about independent genetic assortment here:
https://brainly.com/question/12338476
#SPJ1
One group of rabbits lives in a forest in New York. Another group of rabbits of the same species lives in a forest in Connecticut. Are these two groups of rabbits part of the same population? Explain your answer
Yes. The two groups of rabbits are part of the same population.
What is a population?In biology, a population refers to a group of individuals of the same species living within the same particular geographical area at a particular time.
From the definition, 3 factors are important for a group of living organisms to be of the same population:
They must be of the same speciesThey must be within the same geographical boundaryThey must be there at the same timeIn the illustration, the first group of rabbits lives in a forest in New York while the second group lives in Connecticut. When you consider the fact that-
the two populations consist of rabbits of the same speciesNew York and Connecticut are just about 96 miles apart- you know that the two populations are likely from the same population but become separated geographically as a result of human activities.
If these two populations do not interact in any way for a long time and the environmental factors of New York differ from that of Connecticut, they may eventually evolve to become different populations.
More on populations can be found here: https://brainly.com/question/27991860
#SPJ1
What is the best evidence that all life evolved from prokaryotic rather than eukaryotic ancestors?.
Best evidence that all life evolved from prokaryotic rather than eukaryotic ancestors is : the oldest fossil form of life known is prokaryotic.
How can you say that life evolved from prokaryotic ancestors ?The evidence that show that life evolved from prokaryotic ancestors is that the oldest fossils found are prokaryotes. The oldest bacterial fossils is of about 3.5 billion years ago whereas the oldest eukaryotes discovered are about 2.1 billion years old.
Microbial mats or large biofilms represent the earliest forms of prokaryotic life on Earth.
The hypothesis is that eukaryotic cells evolved from a symbiotic association of prokaryotes which is called endosymbiosis. It is well supported by studies of mitochondria and chloroplasts, which are thought to have evolved from bacteria residing in large cells.
To know more about evolution, refer
https://brainly.com/question/12271572
#SPJ4
Researchers have discovered that the value of r in aphids depends on the average temperature where the population lives, suggesting that climate change could affect population growth in aphids. Interpret the model.
The r model of growth in aphids depends on the average temperature where the population lives, thereby effectively climate change can affect population growth and an increase in average temperature may lead to overpopulation or extinction of the insect population.
What is the r model of growth?The r model of growth (also called latent growth) is used to indicate exponential growth when certain climate features are reached, ie, in absence of environmental constraints. This type of exponential growth (r model of growth) is characteristic of some groups of insects.
The presence of external new factors such as a sudden raise in the average temperature may drastically affect the number of individuals in species under an r model of growth.
Therefore, with this data, we can see that the r model of growth is affected by climate variables and therefore climate change may alter the number of individuals in the target population.
Learn more about the r model of growth here:
https://brainly.com/question/13427229
#SPJ1
In the last step of shotgun sequencing, a computer analyzes a large number of fragment sequences to determine the dna sequence of a whole chromosome. Given the following fragment sequences, what is the overall dna sequence?.
Using the theories of chromosome, we got that GATGACATGGCGTCAGTCGATGCG is the DNA sequence of a whole chromosome in the last step of shotgun sequencing.
Shotgun sequencing is the laboratory technique for determining the DNA sequence of an organism’s genome. The method actually involves randomly breaking up the genome into the small DNA fragments that are sequenced individually. A computer program looks for the overlaps in the DNA sequences, using them to reassemble the fragments in the correct order to reconstitute the genome
Hence, during the last step of shotgun sequencing, a computer analyzes a large number of fragment sequences to determine the DNA sequence of a whole chromosome, the DNA sequence is GATGACATGGCGTCAGTCGATGCG.
To know more about chromosome, visit here:
https://brainly.com/question/1596925
#SPJ4
In the 1920s, hermann muller discovered that x-rays caused genetic changes in the fruit fly drosophila. In a related series of experiments in the 1940s, other scientists discovered that other types of chemicals have a similar effect. A new chemical food additive is developed by a cereal manufacturer. Why is it necessary to test for its ability to cause mutation?.
A new chemical food additive was developed by a cereal manufacturer and it was necessary to test for its ability to cause mutation because they wanted to prevent any chance that it might cause mutations.
What is Mutation?This is usually caused by an alteration of single base units in DNA therefore resulting in a change in the structure of a gene and may be transmitted t subsequent generations of the species.
Since it was discovered that x-rays and other chemical compounds had the possibility to cause mutation then necessary tests and observations have to be done by trained professionals.
This is to ensure that any form of chance that might cause mutations is prevented so as to make it safe for eating and is therefore the reason why it was chosen as the correct choice.
Read more about Mutation here https://brainly.com/question/17031191
#SPJ1
when a circular dna gets underrotated by the action of cellular enzymes, the dna is said to exhibit negative supercoiling. positive supercoiling. relaxed state. bubbling.
When a circular DNA gets underrotated by the action of cellular enzymes, the DNA is said to exhibit Negative supercoiling.
Negative supercoiling is a form of DNA underwinding in which the number of twists is less than what is predicted by the number of helical turns. This can be caused by enzymes that unwind DNA, or by DNA-binding proteins that bend or distort the molecule.Negative supercoiling makes DNA more compact and can affect its function, such as by affecting the binding of proteins. The double helical, right-handed type of DNA is called positive supercoiling. It is tightly twisted in a right-handed manner until a knot-like helix forms. DNA has a left-handed, double helical structure known as negative supercoiling. Negative supercoil' s knot has a high twisting stress despite the helix being underwound and having low twisting stress.
To know more about DNA check the below link:
https://brainly.com/question/16099437
#SPJ4
Mark places some cells from an onion skin on a microscope slide. He uses a freshwater solution to make the wet-mound slide. When he observes the cells under the microscope for an extended period of time, what is he most likely to see?.
When he observes the cells under the microscope for an extended period of time, The cells have dissolved, destroying the cell walls.
What is microscope ?A microscope is a instrument used to examine objects too small to be seen with the eye. Microscopy is the science of examining small objects and structures with a microscope.Microscopic means invisible without the assistance of a microscope. A microscope is an instrument utilized to magnify small objects. Some microscopes can also be used to view objects at the cellular level, allowing scientists to see the shape of cells, their nuclei, mitochondria, and other organelles. A microscope is a device that allows people to see very small things that their eyes cannot see. Microscopes use glasses or magnifying glass-like lenses to make things appear larger.To learn more about microscope from the given link :
https://brainly.com/question/18661784
#SPJ4
a few normal adult cells retain the ability to divide indefinitly, replacing cell lineages that die out, these immortal cells are called
A few normal adult cells retain the ability to divide indefinitely, replacing cell lineages that die out. – These immortal cells are called stem cells.
What is the term for cells that continue to divide?In cell biology, the process of mitosis (/matoss/), during which replicated chromosomes are split into two new nuclei, is a stage of the cell cycle. The number of chromosomes is maintained in the genetically identical cells produced by cell division.
How do immortal cells work?
Immortalized cell lines are cells that have been made to reproduce endlessly so they can be grown in cultures for a long time. Immortalized cell lines come from a range of origins, such as cancers, that have chromosomal defects or mutations that allow them to divide indefinitely.
To know more about immortal cells visit:-
https://brainly.com/question/274381
#SPJ4
The transpiration pull is due to the ________ that causes water to move up through the xylem that begins at the surface of mesophyll cells.
The transpiration pull is due to the negative pressure potential that causes water to move up through the xylem that begins at the surface of mesophyll cells.
Transpiration is the process in which the water travels through the plant and evaporates through the open surfaces of plant like stem, leaves or flowers. Stomata is the main component in the leaves and stem that causes transpiration.
Negative pressure potential arises due to high content of solutes in any cell. The top of any plant is high on solutes while the bottom or root part has optimum amounts of water. This is the reason why the abundance of solute and negative pressure potential causes the water to rise up.
Learn more to transpiration visit here;
brainly.com/question/13891305
#SPJ4
Biogeochemical cycles _______. a. are not essential for life b. move through abiotic and biotic regions c. are the result of natural disasters d. provide the greatest amount of energy for the earth please select the best answer from the choices provided a b c d
Biogeochemical cycles move through abiotic and biotic regions.
They are the connection and movements
that exist between living elements (biotic
factors) and non-living elements (abiotic
factors) in order for energy to flow.Biotic and abiotic factors are what make up ecosystems. Biotic factors are living things within an ecosystem; such as plants, animals, and bacteria, while abiotic are non-living components; such as water, soil and atmosphere. The way these components interact is critical in an ecosystem.Both these components are reliant on each other. Suppose if one of the factors is removed or altered, its repercussions will be faced by the entire ecosystem. Without a doubt, abiotic factors directly affect the survival of organisms.
To know more about Biotic and the abiotic visit:https://brainly.com/question/19535386
#SPJ4
The phenotypic ratio of the f2 generation of the dihybrid cross in mendel’s experiment with pea plant was.
In Mendel's experiment with the pea plant, the phenotypic ratio of the f2 generation of the dihybrid cross was 9:3:3:1.
What might plants of the F2 generation look like phenotypically?Four phenotypes can be seen in the F2 generation, which results from the cross of two such plants. In the ratios of 9:3:3:1: round and green, round and yellow, wrinkled and green, and wrinkled and yellow.
What is a Mendel of the F2 generation?By definition, a cross between two F1 people produces the F2 generation (from F1 generation). A 3:1 ratio was observed as a result of Gregor Mendel's tests across three generations (i.e. for every three purple-flower-bearing plants there would be one white-flower-bearing plant)
To know more about Mendel's visit:-
https://brainly.com/question/3186121
#SPJ4
Why is it important not to leave fingerprints or scratch the sample cells in spectrophotometric measurements?.
Using the theories of the cell, we got that Scratches and fingerprints on the surface of the cell can decrease the amount of light that reaches the detector is the reason not to leave fingerprints or scratch the sample cells in spectrophotometric measurements.
This instrument depends on a careful usage to measure accurately the concentration in an specific solution. The wavelength can be inaccurate if some procedures were not done during the preparation process.
When cleaning the cuvette or manipulating it, always use a lint free cloth and make sure that you removed any drops of water that might have fallen into the cuvette.
Hence, the reason not to leave fingerprints or scratch the sample cells in spectrophotometric measurements is because Scratches and the fingerprints on the surface of the cell can decrease the amount of light that reaches the detector.
To know more about cells, visit here:
https://brainly.com/question/3142913
#SPJ4
Question 6
The model shows parts of an atom. What term iden-
tifies the parts of the atom labeled with a Y?
X
Most of an atom's mass comes from the protons and neutrons that make up its nucleus. The electron is the least massive particle in the atom, with a mass of 9.11 x 10-31 kg, too small to be measured by current techniques.
The current atomic model can be decomposed into three elements protons neutrons and electrons. Each of these moieties has an associated charge, protons have a positive charge, electrons have a negative charge, and neutrons have no net charge. Each electron follows a specific path around the nucleus.
The diagram below shows some elementary particles. The atomic structure of matter consists of protons electrons and neutrons. Protons and neutrons form an atomic nucleus surrounded by electrons that belong to atoms. The atomic number of an element represents the total number of protons in its nucleus.
Learn more about An atom here:-https://brainly.com/question/17545314
#SPJ9
Which choice identifies the flow of information according to the central dogma of molecular biology?.
The central dogma of molecular biology the information flows from genes (DNA) to mRNA to proteins (amino acids).
What is central dogma?The term Central Dogma has been defined as the term that refers to the two step process through which information flows from the sequence of DNA into a sequence of RNA (the process of transcription) and finally takes the form of proteins (the process of translation).
This is the process that ensures that genetic information of all living organisms is preserved and transmitted without any alteration or changes into their offspring and Francis Crick was the first scientist who proposed the term of "Central Dogma".
Therefore, The central dogma of molecular biology the information flows from genes (DNA) to mRNA to proteins (amino acids).
Learn more about molecular biology on:
https://brainly.com/question/19138651
#SPJ1
Recent evidence suggests that the __________ plays a particularly central role in the modulation of emotion.
Recent evidence suggests that the amygdala plays a particularly central role in the modulation of emotion.
The amygdala is widely thought to be the neural system's core for processing fearful and threatening stimuli, including threat detection and activation of appropriate fear-related behaviors in response to threatening or dangerous stimuli. The amygdala is in charge of processing strong emotions like fear, pleasure, or anger. It may also send signals to the cerebral cortex, which is in charge of conscious thought. Physical reactions are controlled by signals sent from the thalamus to the autonomic nervous system and skeletal muscles.
The amygdala's primary function is to regulate emotions such as fear and aggression. The amygdala is also involved in associating emotional meaning to memories, Decision-making and reward processing.
To learn more about amygdala, here
https://brainly.com/question/9888781
#SPJ4
