Find the value of x.
26
X
X
x = [?]°

Find The Value Of X.26XXx = [?]

Answers

Answer 1

Answer:

x=77° each

Step-by-step explanation:

180-26=154°

154÷2=77°

x=77° each

hope that helpes


Related Questions

-48.54 divided by -6

Answers

Answer:

-48.54 ÷ -6 = 8.09

so the answer is 8.09

hope this helps


In the lab, Heather has two solutions that contain alcohol and is mixing them with each other. She uses 4 times as much Solution A as Solution B. Solution A is
15% alcohol and Solution B is 12% alcohol. How many milliliters of Solution B does she use, if the resulting mixture has 216 milliliters of pure alcohol?

Answers

Answer:

1200 ml

Explanation:

Let x be the quantity ( in ml ) of b solution,

∵  solution a is 100 milliliters less of than solution  b.

So, the quantity of solution a = 100 - x,

Now, solution a has 13% alcohol,

∴ Alcohol in solution a = 13% of (100-x) =  = 0.13(x-100),

While solution b has 17% alcohol,

∴ Alcohol in solution b = 17% of x = 0.17x,

So, the quantity of alcohol in the mixture of a and b = 0.13(x-100) + 0.17x

= 0.13x - 13 + 0.17x

= 0.30x  - 13

According to the question,

Total quantity of alcohol in the mixture = 347 ml,

⇒ 0.30x  - 13 = 347

⇒ 0.30x = 347 + 13

⇒ 0.30x = 360

⇒ x =  = 1200

Hence, the quantity of solution b is 1200 ml.

What is the equation of the line that
contains (2, 3) and has an undefined slope?

Answers

Answer:

George C. x=2 is the equation of the line through (2,3) with undefined slope.

Step-by-step explanation:

Answer:

x = 2

Step-by-step explanation:

A line with an undefined slope is a vertical line parallel to the y- axis with equation

x = c ( c is the value of the x- coordinates the line passes through )

the line passes through (2, 3 ) with x- coordinate 2 , then

x = 2 ← is the equation of the line

Select all the expressions that have 23 as a product.
2125×5063
78×925
130×23
325×712
2027×2730

Answers

The expression that have 23 as a product is 130×23

How to select all the expressions that have 23 as a product?

For an expression to have 23 as a product, the expression must be a multiple of 23

This is indicated by

x/23 => Integer

So, we have:

2125×5063/23 = 4677..... (false)

78×925/23 = 3136.9....(false)

130×23/23 = 130 --- true

325×712/23 = 10060.... (false)

2027×2730/23 = 240596.. (false)

Hence, the expression that have 23 as a product is 130×23

Read more about factors and multiples at

https://brainly.com/question/24672369

#SPJ1

En una proporcion se sabe a=60 b=25 c-d=14 encuentre c y d

Answers

The numbers that represents c and d and aligns with the information will be 24 - 10 = 14.

How to illustrate the information?

It should be noted that from the proportion, a = 60 and b = 25.

It was also stated that c - d = 14.

It should be noted that 60 and 25 have a common factor of 5. Therefore, the number that's equivalent to them will be:

(60 ÷ 2.5) = 24

25 ÷ 2.5 = 10

Therefore 24 - 10 = 14

The values are 24 and 10.

Learn more about number on:

brainly.com/question/24644930

#SPJ1

Write and post THREE word problems that are JWU college-related and that translate to one-variable linear equations.

Answers

The three questions mentioned above which translated to one variable linear equation.


Problem first,
The rank of a student is 5 more than the other, Sum of their rank is 7
The solution, rank of student be x
            rank of another student = x + 5
          According to the question,
          x + x + 5 = 7
              2x = 2
                 x = 1

Problem second.
A student has 2 pens less than their friend, the sum of their pens is 6
Solution-
               let the student has x pens
               His friends have = x + 2 pens
               Now. total = x + x + 2
                             6 = 2x + 2
                             x = 2

Problem third,
Ashwin is 2 times older than his friend and his friend's age is 24 what is the age of Ashwin,
Solution,
             Let the age of Ashwin be x
                according to question
                    x = 24 + 2
                     x = 26

Thus, the three questions mentioned above which translated to one variable linear equation.



Learn more about function here:

brainly.com/question/21145944

#SPJ1


             

Question 7
1 pt:
By January 2014, the US population had grown to 317.3 million
and the US Federal Debt was a reported $17.3 trillion. Calculate
the beginning-2014 Federal Debt per capita.
Express your answer rounded correctly to the nearest dollar.
Remember, do not include units with your answer!

Answers

In January 2014, the debt per capita was: = $54,522.53.

What is debt per capita?

Net debt per capita is simply the total debt of a country or even other jurisdiction divided by the residents residing there. Net debt per capita can provide insight into how leveraged a government is.

How much debt is considered normal?

The average American has $92,727 in consumer debt, according to 2020 Experian research. Consumer debt encompasses a wide range of personal credit accounts, including credit cards, auto loans, mortgage, and personal loans, including school loans.

According to the given data:

Population = 317.3 million.

US Federal Debt was a reported  = $17.3 trillion.

Federal Debt per capita. = ?

We know that:

by adding short-term and long-term debt, deducting cash and some other liquid assets, then dividing by population.

The debt per capita in Jan 2014 was:

=1.73 x 1013 / 3.173 x 108

= $54,522.53.

To know more about debt per capita visit:

https://brainly.com/question/28597247

#SPJ9

Solve for x then give the measure of the bolded angle.

Answers

Answer:

73 - Explanation and Check below

Step-by-step explanation:

11x - 4 = 9x + 10

1. Get variable (x) on one side.

11x - 4 = 9x + 10

- 9x - 9x

2x - 4 = 10

2. Solve 2 step equation - add 4 on both sides of equation.

2x - 4 = 10

+ 4 + 4

3. Divide 2 on both sides of equation.

2x = 14

---- ----

2 2

x = 7

Check:

11 (7) - 4 = 9(7) + 10

77 - 4 = 63 + 10

73 = 73 True statement.

Explanation:

If a transversal intersects two parallel lines, the corresponding angles will be always equal.

So in the problem, the two given equations are equal to each other.

The answer for the two angles with equations is 73.

Also, the angles vertical to the two equations are also 73 because vertical angles are congruent (equal).

Hope this helps :)

Susan gives five dollars to Joe if Susan started with $18 how much money does she have left

Answers

Susan started with $18 and gave Joe $5:

$18-$5=$13

Susan has $13 left.

RACD holds 2t + 3 tracks.
Write and simplify an expression for the
number of tracks on 4 CDs.
When t = 15, how many tracks are there on
4 CDs?

Answers

The number of tracks on 4 CDs are 132.

Here, we are given that a CD holds 2t + 3 tracks.

Thus, the number tracks on 4 CDs will be given as-

4(2t + 3)

Simplifying the expression further, we get

(4 × 2 × t) + (3 x 4)

= 8t + 12

Therefore, the expression for the number of tracks on 4 CDs is 8t + 12

Now, if t = 15

Then, the number of tracks on 4 CDs can be found by substituting the value t = 15 in the expression (8t + 12)

= 8(15) + 12

= 120 + 12

= 132

Thus, there are 132 number of tracks on 4 CDs.

Learn more about linear equations here-https://brainly.com/question/2030026

#SPJ9

A poll showed that 68.1% of Americans say they believe that statistics teachers know the true meaning of life. What is the probability of randomly selecting someone who does not believe that statistics teachers know the true meaning of life.

Report the answer as a percent rounded to one decimal place accuracy. You need not enter the "%" symbol.
prob =
%

Answers

The probability of randomly selecting someone who does not believe that statistics teachers know the true meaning of life is 31.9%

What is the probability of randomly selecting someone who does not believe that statistics teachers know the true meaning of life?

The given parameters are

P = 68.1%

The above probability represents the probability that Americans say they believe that statistics teachers know the true meaning of life

The complement probability is

Q = 1 - P

This gives

Q = 1 - 68.1%

Evaluate

Q = 31.9%

Hence, the probability of randomly selecting someone who does not believe that statistics teachers know the true meaning of life is 31.9%

Read more about probability at

https://brainly.com/question/24756209

#SPJ1

what is the answer to this-0.8x+40-8x-35

Answers

Answer:

  -8.8x +5

Step-by-step explanation:

You want to simplify the expression -0.8x+40-8x-35.

Like terms

The expression is simplified by combining like terms. Like terms have the same (set of) variables.

  -0.8x +40 -8x -35

  = -0.8x -8x +40 -35 . . . . . . group like terms

  = (-0.8 -8)x +(40 -35)

  = -8.8x +5

(4x y)(5x^2yz) please I need it

Answers

Answer:

(4xy)(5x^2yz) = 20x^3y^2z

Step-by-step explanation:

You need to expand the brackets by multiplying compatible terms together.The numerical ones together and algebraic ones of the same variable together as well.You may follow the following steps to understand the way it is done.

                                        [tex]\begin{aligned}\\\small (4xy)(5x^2yz) &\equiv \small (4\times5)\times (x \times x^2) \times (y\times y) \times (z)\\\\&\equiv 20 \times x^3 \times y^2 \times z\\\\&\equiv 20x^3 y^2 z\end{aligned}[/tex]

-3 x 58 how do I do it.​

Answers

Answer:

-174

Step-by-step explanation:

58x2=116<----First two 58's

116+58=174<----last 58

We need to add the negative symbol since it should be negative, so the final answer is -174.

9(3.2)^2+4x-11 how to solve

Answers

The solution of the given linear equation is (103.16 + 4x).

What is  meant by linear equation?Linear equations are degree 1 equations. It is the straight line equation. The standard linear equation is ax+by+c =0, where a and b are both are not zero. There are only 1 or 2 two variables in a linear equation. In a linear equation, no variable is raised to a power greater than just one or is employed as the denominator of such a fraction. When you find two values that satisfy a linear equation and plot them on a coordinate grid, each of the points fall on the same line.

The given equation is;

= 9(3.2)² + 4x - 11

For finding (3.2)² = 3.2×3.2

(3.2)² = 10.24

Put the value in equation;

= 9×10.24  + 4x - 11

Multiply 9×10.24 = 92.16

Put the value;

= 92.16 + 4x + 11

Now, add the constant value

= (92.16 + 11) + 4x

= 103.16 + 4x

As, 4x is a variable part, it will not get added to the constant 103.16.

Thus, the solution of the equation is  103.16 + 4x.

To know more about the linear equation, here

https://brainly.com/question/12788590

#SPJ9

Tyler Tooling Company uses a job order cost system with overhead applied to products on the basis of machine hours. For the upcoming year, the company estimated its total manufacturing overhead cost at $420,000 and total machine hours at 60,000. During the first month of operations, the company worked on three jobs and recorded the following actual direct materials cost, direct labor cost, and machine hours for each job:

Job 101 Job 102 Job 103 Total
Direct materials used $ 19,200 $ 14,400 $ 9,600 $ 43,200
Direct labor $ 28,800 $ 11,200 $ 9,600 $ 49,600
Machine hours 1,000 4,000 2,000 7,000

Job 101 was completed and sold for $60,000.

Job 102 was completed but not sold.

Job 103 is still in process.

Actual overhead costs recorded during the first month of operations totaled $45,000.

Required:
Prepare a journal entry showing the transfer of Job 102 into Finished Goods Inventory upon its completion.
Prepare the journal entries to recognize the sales revenue and cost of goods sold for Job 101.
Prepare the journal entry to transfer the balance of the Manufacturing Overhead account to Cost of Goods Sold

Answers

1. The journal entry to show the transfer of Job 102 into Finished Goods Inventory after its completion is as follows:

Journal Entry:

Debit Finished Goods $53,600

Credit Work in Process: Job 102 $53,600

2. The journal entries to recognize the sales revenue and cost of goods sold for Job 202 are as follows:

Journal Entries:

Debit Cash/Accounts Receivable $60,000

Credit Sales Revenue $60,000

Debit Cost of goods sold $55,000

Credit Finished Goods Inventory $55,000

3. The journal entry to transfer the balance of the Manufacturing Overhead account to the Cost of Goods Sold account is as follows:

Journal Entry:

Debit Manufacturing Overhead $4,000

Credit Cost of Goods Sold $4,000

Data and Calculations:

Estimated total manufacturing overhead = $420,000

Estimated total machine hours = 60,000 hours

Predetermined overhead rate = $7 ($420,000/60,000)

                                            Job 101     Job 102          Job 103         Total

Direct materials used       $ 19,200    $ 14,400       $ 9,600     $ 43,200

Direct labor                      $ 28,800     $ 11,200       $ 9,600     $ 49,600

Applied overhead              $7,000     $28,000      $14,000      $49,000

Total costs                       $55,000     $53,600      $33,200     $141,800

Machine hours             1,000 hours   4,000 hours 2,000 hours 7,000 hrs

Status of Jobs                   Sold             Finished      WIP

Sales revenue (Job 101) = $60,000

Manufacturing Overhead Account:

Actual overhead costs for the first month = $45,000

Applied overhead for the first month = $49,000 ($7 x 7,000)

Overapplied overhead = $4,000 ($49,000 - $45,000)

Learn more about manufacturing accounts at https://brainly.com/question/17012365

#SPJ1

Find the equation of a line that passes through the points (-1,5) and (3,-3). Write the equation in slope-intercept, point-slope, and standard form.
You must show all of your work to receive credit.

Answers

Answer: The answer for this would y=-2x+b in slope form and y=-2x+3 in standard form.

Step-by-step explanation:

First we have to figure out what the slope is and you should this formula y2-y1/x2-x1 you plug in the coordinates and your equations should look like this -3-5/3-(-1)= -8/4 which simplified into -2. In standard form you put in the same equation but plug in the coordinates with the slope so it would look like this. -3=-2(3)+b and you would get 3 as b and then you substitute it in the equation again y=mx+b and it should like this in standard form y=-2x+3.

5 2/3 + 29/69 + 6 21/23

Answers

Answer:13

Step-by-step explanation:

Answer:

13

Step-by-step explanation:

i hope it's helpful for you

Need to find the value of x

Answers

X=2 because (10x-14)=(7x-8)

i know how to do a and c, but how do i do b)?

Answers

Answer:  0

Explanation:

Start at -1 on the x axis number line. Then move vertically until reaching the function curve. You should arrive at (-1,2). This tells us that g(-1) = 2. In other words, the input x = -1 leads to the output y = 2.

Follow similar steps to find that g(1) = -2

Therefore, g(-1)+g(1) = 2 + (-2) = 0

Your teacher has 35 balloons. She buys 4 packs of balloons. Each pack has 10 balloons. How many does she have now?

Answers

Answer:

75

Step-by-step explanation:

35+4x where x is 10

35+4*10

35+40

75

Answer:

75

Step-by-step explanation:

4 packs of balloons which each have 10 balloons is 40 total balloons she bought. Add 40 to 35 which is 75.

Identify all obtuse angles in the drawing below.
*
O ZBMD, ZAMC, ZAME
O ZBMC, ZCME
O ZAME
O ZAMB, ZCMD, ZDME

Answers

The required angle of obtuse angles are <BMD  ,<AMC  and <AME.

What is angle?

In Plane Geometry, a figure which is formed by two rays or lines that shares a common endpoint is called an angle and corner whether constituting a projecting part or a partially enclosed space.

Given:

The given figure is shown

<BMC=EMC=90°

According to given question we have

Angles between 90 and 180 degrees (90°< θ <180°) are known as obtuse angles.

Angles that are 90 degrees (θ = 90°) are right angles.

Angles that are 180 degrees (θ = 180°) are known as straight angles.

Angles between 180 and 360 degrees (180°< θ < 360°) are called reflex angles.

<BMC=EMC=90° (right angles)

<BME =<AMD= 180°( straight angles)

<BMD=<AMC=<AME =90°< θ <180°  (obtuse angles )

Therefore, the required angle of obtuse angles are <BMD  ,<AMC  and <AME.

Learn more details about angle  here:

https://brainly.com/question/13954458

#SPJ1

420 ÷ d = 30; d= 15
[tex]420 \div d = 30 \: d = 15[/tex]

Answers

The required answer for the given equation is d = 1/2, ±√14.

What is division?

The division is one of the four basic mathematical operations, the other three being addition, subtraction, and multiplication.

Now the given equation is,

420 ÷ d = 30d = 15

Now if,

30d = 15

Then divide both the side by 30 we get,

30d/30 = 15/30

Solving we get,

d = 1/2

this is the required value of d

Now if,

420 ÷ d = 30d

So simplifying it we get,

420/d = 30d

multiplying both the side by d we get,

d*420/d = 30d*d

Solving we get,

30d^2 = 420

Dividing both the side by 30 we get,

30d^2/30 = 420/30

Solving we get,

d^2 = 14

Taking square root both the side we get,

√d^2 = √14

Solving we get,

d = ±√14
this is the required value of d.

Thus, the required answer for the given equation is d = 1/2, ±√14.

To learn more about Division :

brainly.com/question/28032495

#SPJ1

Zodwa, the operations manager of a large production plant would like to estimate the mean
amount of time a worker takes to assemble a new electronic component. Assume that the standard
deviation of this assembly time is 3.6 minutes.
3.1.1. After observing 120 workers assembling similar devices, Zodwa noticed that their
average time was 16.2 minutes. Construct a 92% confidence interval for the mean
assembly time. (9)

Answers

The confidence interval for the mean assembly time is [15.625, 16.775].

The mean (x) time of the workers to assemble similar devices is 16.2 minutes.The standard deviation (σ) of this assembly time is 3.6 minutes.The sample size (n) for observation is 120 workers.It is given that the confidence level is 92%.At α = 0.08, the critical value (z) is 1.751.The confidence interval for the mean assembly time is [x ± z(σ/√n)].The confidence interval for the mean assembly time is [16.2 ± 1.751(3.6/√120)].The confidence interval for the mean assembly time is [16.2 ± 1.751(3.6/10.954)].The confidence interval for the mean assembly time is [16.2 ± 1.751(0.329)].The confidence interval for the mean assembly time is [16.2 ± 0.575].The confidence interval for the mean assembly time is [15.625, 16.775].

To learn more about standard deviation, visit :

https://brainly.com/question/14747159

#SPJ9

c² +16c+n
how to solve for N

Answers

Solve the quadratic equation

  c² +16c+64 = 0

The solution of this The solution of this quadratic equation are -8 and 0. are -8 and 0.

Step-by-step explanation:

Given that

The quadratic equation

             c² +16c+64 = 0

To find

The solution of this quadratic equation

So, according to the question

we have,

c² +16c+64 = 0

We can solve this quadratic equation by factorising method.

So, we have to convert it on factors,

        c² +16c+64 = 0

For getting it's factors, we have to divide 16c part in two parts,

So, we can write 16c = 8c + 8c,

        c² +16c+64 = 0

        c² +8c+ 8c+ 64 = 0

Now,

        c(c +8) + 8(c+ 8) = 0

                  (c+8)(c+8) = 0

                        (c+8)² = 0

 or,

                       (c + 8) = √0   (∵  √0  = 0)

                         c + 8 = 0

Now, we can say that

                              c = -8 or 0

Answer:

The solution of this quadratic equation are -8 and 0.

To learn more about quadratic equation, please click on the link:

https://brainly.com/question/1863222

#SPJ9

Drag each number to the correct location on the equations.each number can be used more than once.
(Need help asap)

Answers

Answer:

sin = 12/15  cos = 9/15  tan = 12/9

Step-by-step explanation:

Easy way to remember this is

SOH CAH TOA

O is opposite ( 12 in this problem )

H is hypotenuse i.e. opposite of the right angle ( 15 in this problem )

A is adjacent ( 9 in this problem )

Assume that women’s heights have a distribution that is symmetric and unimodal , with a mean of 69 inches and the standard deviation is 1.5 inches

Answers

Using the normal distribution, the height of a woman with a z-score of -1.5 is of 66.75 inches.

What is the missing information?

The problems asks for the height of a woman with a z-score of -1.5.

Normal Probability Distribution

The z-score of a measure X of a normally distributed variable with mean [tex]\mu[/tex] and standard deviation [tex]\sigma[/tex] is given by:

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

The z-score measures how many standard deviations the measure is above or below the mean. Looking at the z-score table, the p-value associated with this z-score is found, which is the percentile of X.

For this problem, the parameters are given as follows:

[tex]\mu = 69, \sigma = 1.5, z = -1.5[/tex]

The height is found solving for x, hence:

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

-1.5 = (X - 69)/1.5

X - 69 = -1.5 x 1.5

X = 66.75.

The height of a woman with a z-score of -1.5 is of 66.75 inches.

More can be learned about the normal distribution at https://brainly.com/question/24808124

#SPJ1

can someone help me with this
thanks so much for the help!

Answers

For the given graph:

domain is D: [-2, 0)range is R: [0, 2)

And yes, it is a function.

How to find the domain and range of the given function?

For a given function y = f(x), the domain is the set of the inputs (possible values of x) and the range is the set of outputs (possible values of y).

To identify the domain we need to look at the x-axis (the horizontal one)

We can see in the left side that the first value is -2, whith a closed circle, meaning that the value belongs to the domain.

The right side is x = 0, with a open circle, which means that it does not belong to the domain.

Then the domain is D: [-2, 0)

Similarly, by looking at the y-axis (vertical axis) we can find the range which is:

R: [0, 2)

Finally, how to know if this is a function?

There is something called the "vertical line test". This test says that if you can't draw a vertical line that intersects the graph in two points or more, then it is a function.

And the graph clearly meets that test, so it is a function.

If you want to learn more about domain and range:

https://brainly.com/question/10197594

#SPJ1

Find the difference between the sum of the first 500 odd numbers and the sum
of the first 500 even numbers.

Answers

Sum of the first 500 even is 2

Adele bought B packs of baseball cards and five packs of book bar cards right in expression that shows how many packs of sport cards Adele bought
in all

Answers

The expression to show the total number of sport cards that Adele bought will be Bb +5d.

How to illustrate the information?

From the information, it was stated that Adele bought B packs of baseball cards and five packs of book bar cards right in expression that shows how many packs of sport cards Adele bought in all.

Let the number of baseball = b

Let the back cards =d

Therefore, the expression to show the number of sport cards will be:

= (B × b) + (5 × d)

= Bb +5d

Therefore, the expression to show the total number of sport cards that Adele bought will be Bb +5d.

Learn more about expressions on:

brainly.com/question/25968875

#SPJ1

Adele bought B packs of baseball cards and five packs of book bar cards right in expression that shows how many packs of sport cards Adele bought in all. Write an expression for this

Other Questions
Which functional group, if found in the r group of an amino acid, would most likely be able to form an ionic bond force with a charged amino group on another molecule?. Determine whether the events are mutually exclusive or not mutually exclusive. Then find the probability. Round to the nearest tenth of a percent, if necessary.drawing an ace or a heart from a standard deck of 52 cards For a second order reaction, the initial reactant concentration, [a]o, is 0.93 m. after 16.7 s, the concentration is 0.65 m. what is [a] after 84 s? Place these words in the correct order based onthe most gravity to the least gravity.UniverseMoonPlanetGalaxyStar Juan's professor lectures on the fact that certain features in animals have been passed down from one generation to another. what theory is juan's professor probably describing? If you have three junit test methods written in the same testing class and the first one fails its assertions, will he other methods still be executed? A bakery is making whole-wheat bread and apple bran muffins. for each batch of break they make $35 profit. for each batch of muffins, they make $10 profit. the break takes 4 hours to prepare and 1 hour to back. the muffins take 0.5 hours to prepare and 0.5 hours to bake. the maximum preparation time available is 16 hours. the maximum bake time available is 10 hours. let x = Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA In civil rights literature, which ideology was often at odds with multiculturalism? A. Disillusionment B. Symbolism C. Disenfranchisement D. Black Power Based on what you know of the peptide bonds that link together amino acid residues, why would proline's side chain reduce the flexibility of the backbone? What are "affiliates" asKing uses the word?Consider the context of how the word is used multiple times in paragraph 2. The frequency of a microwave signal is 9.76 ghz. what is its wavelength in meters? help me asap im in a dba back to basics exam and didnt study Imagine that an employer purchases a health insurance plan that costs $365 per month, but requires that the employee pay $35 per month toward the cost of the plan. If the employee's salary is What is the slope of the line that passes through the points (6,2) and (-18,2) If you had to choose one scene from Equianos story to turn into a visual illustration in order to capture his narrative, which one would it be and why? A 78-year-old man is admitted to the emergency department (ed) with bradycardia resulting from overdose of donepezil. the nurse knows that the ed is likely to order which medication? If you see a 1st quarter moon today, what will people on the other side of the earth see later today? What elected group's laws and regulations make laboratory safety a legal requirement in the united states of america? After administering medication to a client subcutaneously, the nurse removes the needle at the same angle at which it was inserted. which explains the nurse's action?