Answer:
1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d. The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
What is an Archimedean screw used for?
1. To move things from a higher level to a lower level.
2. To change the orientation of an object.
3. To change the direction of an object.
4. To move things from a lower level to a higher level.
Answer: c
Explanation:
The Archimedean screw is to move things from a lower level to a higher level.
What is the Archimedean screw?
The Archimedean screw is one of the oldest and most usefull hydraulic machines. It is said to have been developed by Archimedes himself in ancient Greece.
The basic use of the Archimedean screw is to lift water from a lower to a higher point therefore, the use of the Archimedean screw is to move things from a lower level to a higher level.
Learn more about Archimedean screw: https://brainly.com/question/10095561
Compare and contrast safe practices used during field investigations with those used in laboratory situations.
Answer:
in the field you know how to swim and dive, have appropriate diving equipment, and appropriate diving certifications. as in the lab I wore my apron, latex gloves, and safety glasses. I'm if this is wrong I used google
Which abiotic factors would you expect to influence the growth of trees in the mountains?
Number of deer and insects
Types of trees and plants
Rainfall and the location on the mountain
Predator and prey population
Answer:
Rainfall and the location on the mountain
Explanation:
This is the answer because:
Rainfall highly helps the trees on the mountains grow. The location of a tree also matters a lot because it has to be in a spot where it can reach sunlight and lots of rain.
Therefore, the answer is Rainfall and the location on the mountain.
Hope this helps! :D
Which describe the particle or particles that are in the nucleus of an atom 
Answer:
The particles inside the nucleus of an atom are a proton and neutron. These two subatomic particles are determine the atomic mass of an atom. The proton identifies an atom and changes the characteristics of atoms. A proton is a positive charge and a neutron is a neutral charge
Explanation:
3. Evaluate Information Sodium is an example of an alkali metal. The alkoli metals are
found in the leftmost column of the periodic table, known as Group 1. Use the interactive
periodic table to explore the properties of the following alkali metals: lithium (Li), sodium
(No), potassium (K), rubidium (Rb), and cesium (Cs). The animations demonstrate a chemical
property common to alkali metals: they react with water. How does the reactivity vary
among this group of elements? Why might patterns like this be useful to scientists?
Answer: This might be helpful because t is a good basis for organizing elements because each element has a unique number of protons and atomic mass is an indirect way of organizing elements by number of protons.
5. What do porifera use their flagella for?
(1 Point)
O swimming
O eating
reproducing
Answer:
Porifera use their flagella to eating.
Explanation:
Porifera are immobile animals, typical of marine ecosystems, also called sea sponges and characterized by a lack of true tissue.
Coanocytes are one of the main cells of the porifers, and they are endowed with flagella that allow them to mobilize the water with food particles towards the microvilli, structures that trap them to be later absorbed.
The flagella play an important role in the feeding of the porifers, by conducting the food to the structures responsible for its absorption and processing.
The other options are not correct:
Porifera is immobile, so the flagella do not participate in swimming.Flagella do not participate in the reproductive process of marine sponges.What is the best definition for ecosystem
Answer: An ecosystem is a biological community of living organisms that are interfacing with the nonliving components of their environment, interacting as a system.
An atom contains 15 electrons. How many energy levels would it have?
It would have 8 energy levels
Answer: i'm pretty sure its 3!
Explanation:
ONLY ONE RIGHT ANSWER
HELP PLEASE
The organelle that converts energy from sunlight in a plant cell.
nucleus,
prokaryote,
nucleic membrane,
mitochondria,
chloroplast,
vacuole,
centrioles,
lysosomes
cell,
endoplasmic reticulum,
Golgi apparatus
eukaryote,
organelle,
ribosomes
Answer:
Chloroplast I believe?
Explanation:
Answer:
Chloroplasts
Explanation:
Chloroplasts work to convert light energy of the Sun into sugars that can be used by cells. It's almost like a solar panel that converts sunlight energy into electric energy.
How does the property of cohesion make farming possible?
Answer:
cohesion refers to the attraction of molecules for other molecules of the same kind, and water molecules have strong cohesive forces to make the crops grow faster
Explanation:
Answer:
Cohesion is the forces holding water molecules together. This concept was covered when talking about properties of water and capillary action. You may remember capillary action is like when you have a little bit of water in the bottom of your cup but the water in the straw is a little bit higher than the water in the cup. Because water is polar - meaning it has a somewhat negative end and a somewhat positive end - it is attracted to other water molecules and other substances, such as the straw.
Cohesion
Now, you may be asking yourself: what does a straw have to do with xylem? Well, just like the water moving up the straw, water moves up xylem. The movement of water in plants is from the roots up through the shoot and out the leaves. Part of the reason for this movement of water is cohesion. The water molecules within the xylem tend to stick together, which allows them to help pull other water molecules up through the xylem - even against the flow of gravity.
When water is moving through the xylem, it is moving between different vessels or tracheids. It is very important that these elements are tightly held together because if there are air bubbles, the effects of cohesion are diminished. That is, if air bubbles get into the xylem, the water will no longer move up through these tubes. We can relate this idea back to our straw. If you have ever had a straw that has even a tiny hole in it, you know that it is very hard - even with the aid of suction - to get the water through the straw and up to you. This is what happens if air bubbles get into the tubes of the xylem.
So , indirectly cohesion helps in farming through xylem....
Which characteristic would be most useful in determining if a cell is a plant cell?
Answer:
cell wall
Explanation:
The water cycle involves the constant movement of water from the ground to the atmosphere. Which of these
shows the correct order of the movement of water during this cycle?
Answer:
Evaporation, Condensation, Precipitation and Collection
Explanation:
I just referred to water cycle on the internet.
A carbon atom has 6 protons and 6 electrons. Carbon has three naturally occurring isotopes, carbon-12, carbon-13, and carbon-14. Which of these statements is true about carbon and its isotopes? A.All carbon atoms have six neutrons. B.All carbon atoms have six protons and six electrons. C.Atoms of all carbon isotopes have either more than 6 electrons or fewer than 6 electrons.
Answer:
The correct option is B
Explanation:
Isotopes of the same element have the same atomic number (number of protons) but different mass number. Hence, all the three naturally occurring carbon isotopes mentioned in the question have 6 protons each. Since the number of protons in a neutral atom is equal to the number of electrons in the same atom, each of these isotopes also have 6 electrons.
However, to determine the number of neutrons in each atom, the number of protons (atomic number) is subtracted from the mass number.
Hence, the number of neutrons in carbon-12 is 12 - 6 = 6
the number of neutrons in carbon-13 is 13 - 6 = 7
the number of neutrons in carbon-14 is 14 - 6 = 8
From the explanation above, it can be noted that the number of protons and electrons in isotopes of the same element are the same while the number of neutrons in these isotopes are different. Hence, the correct option is B
Answer:
bbbbbbbbbbbbbbbbbbbbbbbb
Match the part of the viral replication cycle with the order in which it occurs
Column A
Column B
1.
d
1 st
a. viral genome is replicated using host cell's machinery
2.
2nd
b. virus penetrates and inserts genome into cell
3rd
C virus attaches to cell surface
3. 4. 5.
4th
d. new viruses are assembled within host cell
5th
e. the cell ruptures and releases new viruses to infect new
cells
6.
6th
f. viral proteins are synthesized within host cell
Answer:
1. c. virus attaches to cell surface
2. b. virus penetrates and inserts genome into cell
3. f. viral proteins are synthesized within host cell
4. a. viral genome is replicated using host cell's machinery
5. d. new viruses are assembled within host cell
6. e. the cell ruptures and releases new viruses to infect new cells
Explanation:
First, the virus attaches to the cell. Then it penetrates the cell membrane and inserts its genome inside the cell. The virus relies on the cell machinery to synthesize its proteins, and also to replicate its genome.
With these components being synthesized and replicated, new viral particles are assembled inside the host cell. Eventually, the cell ruptures, and the newly assembled viruses are released and able to attach to new cells to repeat the cycle
what is the phase of the moon in each position?
Answer:
The phases of the moon are?
Explanation:
'' New
Waxing Crescent
First Quarter
Waxing Gibbous
Full
Waning Gibbous
Third Quarter
Waning Crescent''
Which best summarizes the effects of mutations on organisms?
A Mutations are sometimes helpful, sometimes harmful, and sometimes neutral.
B Mutations are usually harmful, sometimes neutral, and never helpful.
C Mutations are sometimes neutral, sometimes helpful, and never harmful.
D Mutations are always harmful, never helpful, and never neutral.
Answer:
A Mutations are sometimes helpful, sometimes harmful, and sometimes neutral.
Explanation:
I did the test.
Answer:
A. Would be answer!
Explanation:
Hope this help!
If there is an increase in mass, what has happened?
Answer:
The greater the mass of an object, the less it will accelerate when a given force is applied. For example, doubling the mass of an object results in only half as much acceleration for the same amount of force. Q: Tony has greater mass than the other two boys he is racing (pictured in the opening image).
Explanation:
Answer:
The greater the mass of an object the more it will accelerate! when a given force is applied the mass of the object will change and thats what causes something called speed! Now you will also increase in energy and it will be hard to slow the object down.
Explanation:
See answer
also can i have brainliest!
If a rock sinks, it's density must be
greater than ___?
Can someone help me please??
Which of the following are included in our solar system?
Black holes
Kuiper Belt
Jupiter
Andromeda
the sun
What is the correct answer for question 4? I really need help. I’ll give a thanks, and brainliest.
Answer:
C) carbon dioxide
Explanation:
___ in the eye operate best under bright light conditions
A. Cones
B. Rods
C. Retinal ganglion cells
D. Striate cortex
Answer:
its c
Explanation:
Science PLZZZZZZZ!!!!!
Answer:
Gravity and inertia
Explanation:
C. Gravity and inertia
How are fossils that contain vestigial organs consistent with common ancestry?
Answer:
Explanation:
La evidencia de un antepasado común en los seres vivos, que han encontrado durante décadas científicos que trabajan en numerosos campos, demuestra la descendencia común de estos seres, que la vida en la Tierra se desarrolló a partir de un último antepasado universal, que la evolución existe y que puede demostrar los procesos naturales que han dado como resultado la biodiversidad de la vida en la Tierra. Esta evidencia apoya la síntesis evolutiva moderna, la actual teoría científica que explica cómo y por qué cambia la vida a lo largo del tiempo. Los biólogos evolucionistas han documentado evidencias de antepasados comunes realizando predicciones verificables, probando hipótesis y desarrollando teorías que ilustran y describen sus causas.
La comparación de secuencias genéticas de ADN ha revelado que los organismos filogenéticamente próximos tienen un mayor grado de similitud secuencial que los organismos filogenéticamente alejados. Se pueden encontrar más pruebas de la descendencia común en detritus genéticos como los pseudogenes, regiones del ADN ortólogas a un gen en un organismo relacionado, pero que ya no tienen actividad y parecen estar experimentando un proceso continuo de degeneración por acumulación de mutaciones.
PLEASE HELPPPP !!!! Scientific investigations must be well ____ to be sure the data collected will help answer the scientist’s question.
Answer:
ill try to but try enough =>=
Answer: I just put "well thought out" out of desperation. Sorry I couldn't find the real answer, but this is the best I could do.
Explanation:
Raul wants to study how pot size affects the growth of plants. To do this, he intends to purchase three different pots of varying diameter. Then, he will fill each pot with the same amount of soil and plant different kinds of flowers in each pot. Finally, he will place the pots side by side in a sunny location and water each pot daily with the same amount of water.
Answer:
No
Explanation:
Based on the exact methodology that Raul is using he will never produce valid results. This is mainly due to the fact that there are too many changing variables in his experiment. In order to produce valid results, the experiment can only have one changing variable (independent variable) at a time, while all of the other variables need to be controlled/constant. This would allow Raul to isolate which change is actually causing the desired effect in the plants. The way that Raul has his experiment set-up he will not be able to pinpoint exactly what variable or aspect is actually causing the growth of the plants.
1. WHAT IS THE PURPOSE OF CELLULAR RESPIRATION?
Answer:
Cells do cellular respiration to extract energy from the bonds of glucose and other food molecules.
Explanation:
Answer:
It provides cells with energy they need to function.
Exposure to antigens in the body stimulates it to produce _________ .
Answer:
White blood cells
hjgigoh
A model of an animal cell is shown above. Eukaryotic cells, like this one, have compartmentalization that allows for efficiency in the cell processes. Identify the names, labels, and roles of three eukaryotic organelles that are involved in the transport, packaging, and export of a protein synthesized on a bound ribosome in this cell.
Answer:
Three eukaryotic organelles that are involved in the transport, packaging, and export of a protein synthesized on a bound ribosome in this cell are -
Endoplasmic reticulum Golgi bodiesRibosomesExplanation:
ENDOPLASMIC RETICULUM - The endoplasmic reticulum ( ER) is a broad, dynamic structure that serves many cell functions, including the storage of calcium, protein synthesis and metabolism of lipids. Separate regions, consisting of tubules, sheets and the nuclear envelope, perform the diverse functions of the ER.GOLGI BODIES -: A membrane bound organelle found in most cells is the golgi apparatus. Before secretion, it is responsible for packaging proteins into vesicles and thus plays a key role in the secretory pathway.RIBOSOMES -: The organelles which aid in protein synthesis are ribosomes. For many cell activities, protein is necessary, such as damage repair and other chemical processes.A ribosome is composed of two subunits:
the small ribosomal subunits- these read the mRNA. The large ribosomal subunits - form amino acid polypeptide chains.Hence , the labelled diagram of eukaryotic cell is attached below.
Which statements accurately describe elements? Check all that apply.
Elements are made up of two or more types of atoms.
Elements are made up of only one type of atom.
Each element has a unique chemical symbol.
O Elements can be identified by their atomic number.
One element cannot be combined with another element.
Answer:
Elements are made up of only one type of atom.
Each element has a unique chemical symbol.
Elements can be identified by their atomic number.
In an enzymatic reaction: Select one: a. The enzyme leaves the reaction chemically unchanged b. The least important level of organization for an enzyme is its tertiary structure c. Increasing temperature above the optimal value slows the reaction rate
Answer:
c. Increasing temperature above the optimal value slows the reaction rate
Explanation:
Enzyme activity is affected by factors, such as temperature, pH, and concentration.
The rate of an enzyme-catalysed reaction increases as the temperature increases. However, increasing the temperature above the optimal value slows the reaction rate because the enzyme becomes denatured and can no longer function.
Thus, the correct option is "C"
c. Increasing temperature above the optimal value slows the reaction rate