How do the authors use historical evidence to support their claim? Select two options.

They use a secondary source to show that the British secretary of war opposed involuntary servitude.
They use a primary source to show that a song was spreading the idea of equality across the Caribbean.
They use a secondary source to show that the idea of an enslaved people’s revolt was groundbreaking.
They use a statistic to show that England had enough voters to end slavery and establish equality.
They use a primary source to show that some white people opposed the idea of freeing enslaved people.
By the end of August, the French colony was in flames. So many cane fields were on fire that the air was filled with "a rain of fire composed of burning bits of cane-straw which whirled like thick snow." Smashing mills, destroying warehouses, setting fields on fire, the freedom fighters demolished some one thousand plantations—and that was just in the first two months of their revolution. The fight against sugar and chains soon had a leader, Toussaint, who called himself “L’Ouverture”—the opening. Toussaint was making a space, an opening, for people to be free.

–Sugar Changed the World,
Marc Aronson and Marina Budhos

How do the historical details in this passage support the authors’ claim?

The text describes a revolt in detail to show that enslaved people took action against their treatment on sugar plantations.
The text illustrates the difficult conditions that L’Ouverture and other workers faced while enslaved in Saint Domingue.
The text uses primary sources to emphasize how absentee plantation owners had little control over their plantations.
The text shows that the Haitian slave revolt gave slaveholders cause to increase the number of enslaved laborers on plantations.

Answers

Answer 1

Using historical detail, the narrator supports their claim by using The text describes which a revolt in detail to show that enslaved people took action against their treatment on sugar plantations." (Option A)

What is claim?

In literature, a claim is a statement in which a writer presents an assertion as true in order to prove an argument. A claim can be used as a standalone argument or as one of several claims used to support a broader argument.

What is a historical detail?

A historical fact is an occurrence that impacts people's brains in such a way that it causes unique, permanent changes in their way of thinking, resulting in an unending chain of noticeable repercussions on their way of life.

Learn more about claim:
https://brainly.com/question/2748145
#SPJ1


Related Questions

(looking for) similar meaning ?

Answers

Answer:

similar answer for 'looking for' is 'searching for'

What is the poem "Sojourns in the Parallel World" suggesting about how encounters with
nature causes us to "break free" and to "have changed, a little"?

Answers

The poem suggests that encounters with nature free us from worries and that changes us because it leaves us with an empty mind.

How does the poem show this?By presenting nature as pure.By showing that nature has a renewing power.By showing that nature makes us observe beautiful elements.By showing that nature gives us comfort.

The poet wanted to show the audience how nature plays a joyous role in people's lives and that for this reason, we should have encounters with her more often.

The poem shows that modern life in the city is full of worries, dreams, loves, crimes, projects, and other elements that end our freedom and even our happiness. However, when we meet with nature, our mind is cleansed of all these elements and we become free.

This appreciation of nature is a strong characteristic of romanticism in literature and you can learn more about it at the link:

https://brainly.com/question/821735

#SPJ1

What does the phrase "later in life” contribute to the text?

A. The phrase helps to conclude the text and does not add to the writing.
B. The phrase adds details to the text by summarizing the main idea.
C. The phrase adds a specific detail about time that is relevant to the text’s topic.
D. The phrase helps to introduce the text’s topic by providing a direct object.

Please be as VAGUE as possible

Answers

It can be inferred that the phrase "Later in Life" suggests that there is a particular point in time in the future that adds a different context to the story. Hence, the correct option is (Option C)

What is the an inference?

An inference is a logical method in which informed assumptions about missing bits of information are made based on current information.

Inference is a technique that people utilize all the time in their daily routine: it is the act of extrapolating information.

Based on data, inferences can be utilized to draw logical conclusions. An inference definition in literature is anything learnt by a combination of the reader's knowledge, historical context, and what is known about the author.

What is context?

Context in writing refers to information that assists readers in correctly interpreting the meaning of a work.

Context can take numerous forms, such as background knowledge or specifics about the events, setting, or timeline in which a work is performed.

Learn more about Inference:

https://brainly.com/question/25280941

#SPJ1

Full Question:

Read the paragraph.

Attending career day this spring will be helpful to all seniors, regardless of their future plans. By talking to potential future employers, students can learn about careers they have never heard of before. They can also learn which college degrees may be the most useful to them later in life.

What does the phrase "later in life" contribute to the text?

a. The phrase helps to conclude the text and does not add to the writing.

b. The phrase adds details to the text by summarizing the main idea.

c. The phrase adds a specific detail about time that is relevant to the text's topic.

d. The phrase helps to introduce the text's topic by providing a direct object.

Jose was happy to go on the trip.

Answers

Yes jose was happy for the trip
Jose was definitely happy to go in the trip

write a sentence to describe what you think life would be like for a bird with a broken wing

Answers

life what be a little bit harder but i would be able to walk around just like i see humans do, and if i were a male i most likely wouldn’t be able to entice and mate a female because of said broken wing

marita’s relationship with her mother in 6-10 sentences

Answers

Answer:

mitski songs

Explanation:

The prologue of Romeo and Juliet introduces which elements of the play? Select 4 options.
. the setting of a lovely city
. the setting of a house's courtyard
O the setting of a family tomb
O the characters of the lovers
O the characters of the lovers' parents
O the conflict of a grudge between the two families
the conflict of a fight between the two lovers

Answers

Answer:

hope this help you

Explanation:

the setting of a lovely city

the characters of the lovers

the characters of the lovers' parents

the conflict of a grudge between the two families

Describe how preparing for the festival affects Melantha.

Answers

Melantha is the only and simplest individual in the international. So does anyone else within the international, all precise. She is enthusiastic about tune, art, and a laugh.

Gala's had been scattered in the course of the yr, as many as pebbles on the shore, but this pageant become a unique one. these days Melantha and the other ladies her age would be leaving their toys before the statue of Artemis, displaying they not needed infantile things. Melantha reached into her ribbon-decked basket and cradled the timber ball in her palm, feeling its acquainted heft one closing time, going for walks her thumb throughout the chipped blue and yellow paint.

No, they are involved in the competition said Melantha, kissing the pinnacle of his small head. She pictured herself strolling out the courtyard gate and joining the parade of ladies, all carrying their colorful new finery and wearing weighted down baskets, their pleasure tinged with the solemnity of the event.

Learn more about Melantha here

https://brainly.com/question/17488355

#SPJ1

Place each sentence in the category where it belongs (simple or compound).

Answers

Answer:

SimpleCompoundSimpleCompound

My friend bought a lot of pens before
starting his new job-he really wanted to
make his mark. This is a silly example of a

Answers

Answer:

This is an example of an idiom.

Explanation:

I hope this helps and this is the answer you are looking for!

1.1.10 missing paragraph

Answers

Answer:

i don't know my ff uid :119765724 came let's play

Answer:g

Explanation:

Rhetorical devices: mastery test what is the best statement to describe the pathos rhetorical strategy

Answers

Rhetorical strategies are the writing techniques that authors use to convince the audience of their purpose.

The words you choose to convince, elicit a response from the audience, or demonstrate meaning are known as rhetorical techniques (also known as persuasive rhetorical devices or persuasive strategies). While some individuals would connect these tactics with professional settings, many others unknowingly employ them in everyday discourse. Any time you try to persuade someone, you'll probably employ some sort of rhetorical technique. As you peruse the list that follows, bear this in mind. The use of similes and metaphors is a frequent rhetorical technique when attempting to persuade an audience. These two rhetorical resources both seek to contrast and show similarities between two distinct things. This clarifies the contrast considerably and gives your point more relevance.

To learn more about Rhetorical strategies from the given link:

brainly.com/question/6796727

#SPJ9

100 POINTS AND BRAINLEIST

USE YOUR OWN WORDS!!

you will create your own definition of a journalist. You should:

write your definition in your own words
identify three qualifications that a person must meet in order to be a journalist by your standards
research modern journalists and find at least one who matches your definition
explain what makes him or her a true journalist according to the qualifications you have set out
write a one paragraph response, citing any sources you use

Answers

Answer: For this assessment, you will create your own definition of what a journalist is. You should write your definition in your own words, and you should identify three qualifications that a person must meet in order to be a journalist by your standards. Defend your position in a brief essay of at least three paragraphs, or you may present your definition as a video, podcast, or another creative option that you discuss with your instructor.

Research modern journalists and find at least two who match your definition. Explain what makes them true journalists according to the qualifications you have set out.

Explanation:

You are the main speaker in a debate on the topic churches should be made to pay taxes write your argument for against

Answers

Taxing churches would be placing government above religion which is the argument against the topic 'Churches should be made to pay taxes'.

If we make the procedure of taxing churches, then we will need to tax all as it is not-for-profit organizations.

The government may involve in exempting churches from property taxes and also other taxes as long as they do so for some other charities. There are some people who argue that because as in the case of religious groups on public campuses, the government could not be able to select just some religious groups to tax while leaving all other organizations including schools, women's shelters, soup kitchens as well as fraternal organizations which is tax-exempted.

In order to tax churches, the government should need to have the unconstitutional current authority to audit and in church regulations.

Income is referred to as revenue minus expenses. So, as to tax revenue, the government has certain rules about what counts as business expenses that are legitimate, and many regulations on how some businesses perform their purpose of accounting.

The government may also involve in auditing the organizations. In order to do this for churches, means that the government would be defining what is legitimate and what is not and then act to compliance insurance. This will be raising a constitutional issue as Congress cannot make any laws that affect the free exercise of a particular religion.

Learn to know more about the prohibition of churches on

https://brainly.com/question/24572947

#SPJ4

Which phrase In this excerpt from The Redeemed Captive by John Williams demonstrates a Puritan Influence?
My master took hold of my hand to force me to cross myself; but I struggled with him, and would not suffer him to gulde my hand; upon this,
he pulled off a crucifix from his own neck, and bade me kiss It; but I refused once and again; he told me he would dash out my brains with his
hatchet If I refused.

Answers

My master took hold of my hand to force me to cross myself; but I struggled with him, and would not suffer him to guide my hand; upon this,

This phrase In this excerpt from The Redeemed Captive by John Williams demonstrates a Puritan Influence.

The correct answer for the question that is being presented above is this one: "he pulled off a crucifix from his own neck and bade me kiss it, but I refused once and again; he told me he would dash out my brains with his hatchet if I refused." Puritan influence pertains to the simplifying of doctrines and worship within the Church of England.

learn more about Redeemed Captive by John Williams:https://brainly.com/question/28578466

#SPJ9

1. Why do you think the Women's Rights activists used the Declaration of Independence as a model for the Declaration of Sentiments?

Answers

The Declaration of Sentiments was modeled after the U.S. Declaration of Independence and borrowed language from the antislavery movement, demanding that women be given full rights of citizenship.

What aspects of society does
Miller seem to be criticizing through the characters
of Reverend Parris and the Putnams? (The crucible)

Answers

The Reverend Parris and Putnam appear to be examples of people who are more concerned with themselves, their social status, and power than with the community.

What does Miller criticize in the crucible?

The United States was engulfed in the post-World War II Red Scare when Arthur Miller completed The Crucible in 1952, supported and led by the vehement Joseph McCarthy. McCarthy took an iron grip on the nation's consciousness and started purging communist suspects with the help of the House Un-American Activities Committee, which had been set up in 1938 to prosecute Nazi supporters during World War II. Fear was McCarthy's main tool for maintaining control, and it was fuelled by the lethal force of baseless allegations, confidential evidence and testimony, and unfair judicial procedures. McCarthy's allies picked out members of the theater and Hollywood as lefties and communist sympathizers when The Crucible was originally presented.

To learn more about Miller checkout the link below :

https://brainly.com/question/2008464

#SPJ9

which of the following best states the central idea of paragraph 3 ? twelve years as a slave

Answers

Answer:

just add the pharagraph

Explanation:

is Mandisa correct when she says that Mxolisi is the product of his environment​

Answers

In the novel Mother to Mother by Sindiwe Magona, Mxolisi is a product of his environment. mxolisi was a part of the community before being a pariah.

Sum total of all of the dwelling and non-residing elements and their consequences that have an impact on human existence. whilst all dwelling or biotic factors are animals, flora, forests, fisheries, and birds, non-living or abiotic factors consist of water, land, sunlight, rocks, and air.

The environment can be described as all the matters that are gifts around us, consisting of living and non-residing such things as water, soil, vegetation, and animals and the adaptation of those dwelling and non-dwelling things to their environment.

The environment is the whole thing that is around us, which may be dwelling or nonliving things. It includes physical, chemical, and other herbal forces. the natural environment contains land, water, air, vegetation, and animals. human beings engage with the environment and regulate it.

The surroundings offer us endless blessings that we can't repay for our complete life. As they're linked with the woodland, timber, animals, water, and air. The wooded area and bushes filter the air and absorb harmful gases. vegetation purifies water.

All living beings are accordingly essential for all. hence, environment refers back to the sum general of conditions surrounding an area and time. The scope of the time period 'surroundings' has been changing and widening via the passage of time

Learn more about the environment here:-

https://brainly.com/question/17413226

#SPJ9

craig is a football player training over the summer for the next season coach demands that all players come in at 6:00 am and lift weights until 8 am when practice begins craig gets there at 5 am and begins training what character trait does craig have

Answers

Answer:

Craig has the character trait of an over-achiever and or hardworking

Explanation:

Craig doesn't have to be there at 5 am. He chooses to get there at 5 am to train. This can mean that Craig is over-achieving the expectation and demands of his coach. Craig also might be a hard worker because he attends practice earlier so he can practice more and get better.

I hope this helps and I hope this is the answer you're looking for!

what can you infer about mark Antony's feelings from act 3, scene ii of julius caesar?

Answers

can you provide act 3, scene II for me so i could help??

 "The fairest rose at last is withered" What does this mean please..​

Answers

Answer:

This could be interpreted in many different ways but I believe it falls along the line of beauty. Roses are known for their beauty as flowers and when they wither away, they turn brown and appear dead. This could indicate that the writer is talking about a human's own looks. It could mean that, eventually, all of the prettiest people will lose their looks as they get older.

Explanation:

Examine the following page layout.
Paragraph of text
Paragraph of text
What is wrong with this page layout?

Answers

The page layout is incorrect since there should be more space between the image and the text.

The right answer is A.

The page layout is a representation of a page's visual components. It is a logical way to arrange elements on a page in order to increase its visual appeal and readability.

The crucial step in page layout is selecting the fundamental text and picture strategies, as well as maybe the medium's size or condition. It necessitates education, awareness, and creativity.

What is meant by the page layout?

Page layout: This technique is used to develop publications with a more unique layout, such as newsletters, booklets, or posters. Similar to a canvas, a page layout document lets you add text boxes, photos, and other objects before arranging them anyway you wish on the page.

To Learn more about Page Layout, click the links.

https://brainly.com/question/23140410

#SPJ9

Complete Question - What is wrong with this page layout?

OA There should be more white space between the image and the text

OB. The image should appear at the bottom of the document.

OC. The passage should have more images.

OD. The image should appear at the top of the page.

. Differentiate between needs and wants

• Identify goods and services, and how the economy relates to career opportunities

• Identify the effects of supply and demand on the job market

Key Words
• demand
• economy
• goods
• needs
• services.
• supply
• surplus
• wants

(This is actually career planing but they didn’t have this subject on here)

Answers

Differentiate between needs and wants A want is something that is needed to continue to exist. A want is some thing that an man or woman desires, but would be capable of live with out. A number one distinguishing feature of a need is that it's miles vital to maintain economy.

The economy relates to career opportunities

While an man or woman is hired, they're paid by using their organisation. This consequences in them having money to spend on food, garb, enjoyment, and in a spread of different areas. The extra an person spends, the more that demand will increase.the

Whilst the quantity of employees demanded is same to the labor force available, the activity marketplace reaches its equilibrium point, and wages can be decided. The wage level rises when the call for is more than the supply and lowers when the supply exceeds the call for for workers.

In step with most economics textbooks, our wages are decided similarly to another fee: by using supply and demand. humans deliver their hard work, and organizations demand it, developing a market for exertions.

Learn more about the economy here:-https://brainly.com/question/1106682

#SPJ9

HELP I NEED AN ANDWER!!! Lesson: creating and Using Thesis Statements
Click to review the online content. Then answer the question(s) below, using complete sentences. Scroll down to view additional
questions
Creating and Using Thesis Statements"
Create a purpose statement based on the graphic organizer in "Section II: Finding the Main Point."

Answers

A thesis statement describes the topic of the rest of the paper as well as what the writer intends to argue.

What thesis statement is?

It may sound absurd, but it's true. Of course, I refer to the thesis statement. A dissertation statement is an entire essay when it is summarized in one sentence. If the essay title is a question, the thesis statement is her one-sentence answer.

Why is the thesis statement important?

As I said before, the way you write your paper can determine first grade and fail. But how?

To answer that, let's consider what a "thesis" is. From the Greek word thesis, which means "theorem," your thesis is your main argument. This is the position I must support and defend for the rest of my essay. With nothing to defend, the fortresses you build crumble and the armies you deploy run around like headless chickens.

What should my paper include?

What your paper stands for depends on three things:

1. Subject and topic of the essay.

2. Purpose of the essay.

3. essay length.

To learn more about thesis statement, click below

https://brainly.com/question/27811693

#SPJ1

Answer:

For the first question, I put;

This paper will break down exactly why schools should provide training in not only the practice of public speaking, in and outside of the classroom, but also the practice of how to prepare a speech and ways to get over one’s stage fright.

And for the second, I put;

Is my thesis statement clear and to the point? Does it cover all of the evidence and facts within the essay? Does my thesis statement include the topic of this essay?

Explanation:

Needless to say, I couldn't find a single reliable answer under this question/assignment, so I put mine. Though, beware I submitted this and, although I'm not sure why I got a 50%. I'm sorry if this isn't helpful enough, but I really did try, although it was pretty confusing. There was no one on Brainly (that I could find) with the answer, or even close, so I decided to answer this one with my half score in hopes of being a tad bit helpful...  

The lady or the tiger?

Answers

what’s the context because it’s only a question?

Because Ben is blind, he has a guide dog named Bill. Bill is a Jack Russell terrier. So is Ben. In February, a dog-pound owner found the dogs living on the streets of Averley, England. The pooches, both about 4 years old, had formed a special bond. Now, when Ben needs help getting around, he grabs hold of the back of Bill's neck, and Bill helps lead him.

One dog ______ Other

supports

observes

disturbs

obeys

Answers

Answer: Supports

Explanation: they created a special bond

What is needed for juxtaposition in a literary text?

Answers

It requires putting to things aside and informs the reader’s understanding in a comparison like the girl was nice but she was nothing like her sister. :) hope this helps as an example

Read the following paragraph. How does sentence 4 develop the main idea of the paragraph?

Gertrude Belle Elion was born on Jan. 23, 1918, in New York City.
She graduated from Hunter College in New York City with a degree in biochemistry in 1937.
Unable to obtain a graduate research position because she was a woman, she took a series of jobs, including lab assistant, chemistry and physics teacher in New York City high schools, and research chemist.
During this time she also took classes at New York University, where she earned a master's degree in 1941.
Because she could not devote herself to full-time studies, Elion never received a doctorate.
This sentence tells readers where she went to school for her doctorate degree.
This sentence shows Elion's determination and commitment to learn.
This sentence shows that Elion had to try many schools to get accepted into one.
This sentence proves the idea that Elion had to learn biochemistry in unusual ways.Read the following paragraph. How does sentence 4 develop the main idea of the paragraph?

Gertrude Belle Elion was born on Jan. 23, 1918, in New York City.
She graduated from Hunter College in New York City with a degree in biochemistry in 1937.
Unable to obtain a graduate research position because she was a woman, she took a series of jobs, including lab assistant, chemistry and physics teacher in New York City high schools, and research chemist.
During this time she also took classes at New York University, where she earned a master's degree in 1941.
Because she could not devote herself to full-time studies, Elion never received a doctorate.
This sentence tells readers where she went to school for her doctorate degree.
This sentence shows Elion's determination and commitment to learn.
This sentence shows that Elion had to try many schools to get accepted into one.
This sentence proves the idea that Elion had to learn biochemistry in unusual ways.

Answers

Sentence 4 develops the main idea of the paragraph by showing Elion's determination and commitment to learn. Hence the main idea that the paragraph is trying to convey is that Elion was determined and committed towards getting her education.

This paragraph is trying to tell us about the life of Elion, like where she was born and on what date where did she get her education from or about her various jobs. Elion was unable to get a graduate research position just because she was woman. She did a lot of small jobs to be able to further pursue her education, she ended up getting her masters degree from New York University.

To know more about Elion click below:

brainly.com/question/16743985

#SPJ1

Which of the following best describes the denotation and connotation of the words game and gritty in the following sentences?
Tobias is a gritty combatant, determined to win at all costs.
Sandra was game to try anything once.
OA. The words game and gritty share a denotative meaning, and both words have negative connotations.
OB. The words game and gritty are synonyms and have positive connotations.
OC. The word gritty has negative connotations, and the word game has positive connotations.
OD. The words game and gritty share a denotative meaning, and both words have positive connotations.

Answers

The phrase gritty has poor connotations, and the phrase recreation has advantageous connotations this describes the denotation and connotation of the phrases recreation and gritty.

What are Connotation and Denotation phrases?

Connotation is the emotional creativity of the environment in the phrase. Unlike the Denotation, it does now no longer provide the literal feel or which means.

Denotation is the stern literal or dictionary which means a phrase. Denotation represents the express or referential means of a sign., Unlike Connotation phrases it offers the dictionary which means a phrase.

Here the phrase "gritty" means "unpleasant" which denotes poor which means and connotates poor feel.

Also, the phrase "recreation" denotes a physical exercise that suggests an advantageous feel.

To learn more about Connotations, visit the following link:

https://brainly.com/question/14905866

#SPJ9

Other Questions
According to the data presented in the map, which of the following conclusions can be drawn about the population distribution in Pakistan? Pakistan has a low physiological density. Arithmetic density is highest in major cities. Agricultural density is highest in the southwest region. Population density is concentrated in mountainous regions. Physiological density is highest in the northeast. Describe the nucleus in a eukaryotic cell. An inductor is connected to an ac supply. increasing the frequency of the supply _________ the current through the inductor. Explain why you need to vertically align the decimal points when summing decimal numbers. At the north campus of a performing arts school, 30% of the students are music majors. At the south campus, 80% of the students are music majors. The campuses are merged into one eastcampus. If 65% of the 1000 students at the east campus are music majors, how many students did each of the north and south campuses have before the merger? Which functional group, if found in the r group of an amino acid, would most likely be able to form an ionic bond force with a charged amino group on another molecule?. Determine whether the events are mutually exclusive or not mutually exclusive. Then find the probability. Round to the nearest tenth of a percent, if necessary.drawing an ace or a heart from a standard deck of 52 cards For a second order reaction, the initial reactant concentration, [a]o, is 0.93 m. after 16.7 s, the concentration is 0.65 m. what is [a] after 84 s? Place these words in the correct order based onthe most gravity to the least gravity.UniverseMoonPlanetGalaxyStar Juan's professor lectures on the fact that certain features in animals have been passed down from one generation to another. what theory is juan's professor probably describing? If you have three junit test methods written in the same testing class and the first one fails its assertions, will he other methods still be executed? A bakery is making whole-wheat bread and apple bran muffins. for each batch of break they make $35 profit. for each batch of muffins, they make $10 profit. the break takes 4 hours to prepare and 1 hour to back. the muffins take 0.5 hours to prepare and 0.5 hours to bake. the maximum preparation time available is 16 hours. the maximum bake time available is 10 hours. let x = Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA In civil rights literature, which ideology was often at odds with multiculturalism? A. Disillusionment B. Symbolism C. Disenfranchisement D. Black Power Based on what you know of the peptide bonds that link together amino acid residues, why would proline's side chain reduce the flexibility of the backbone? What are "affiliates" asKing uses the word?Consider the context of how the word is used multiple times in paragraph 2. The frequency of a microwave signal is 9.76 ghz. what is its wavelength in meters? help me asap im in a dba back to basics exam and didnt study Imagine that an employer purchases a health insurance plan that costs $365 per month, but requires that the employee pay $35 per month toward the cost of the plan. If the employee's salary is What is the slope of the line that passes through the points (6,2) and (-18,2)