How do the unique chemical properties of water affect water’s ability to occur in three states of matter?

Answers

Answer 1

Answer:

Water's unique properties

In the solid state, the particles of matter are usually much closer together than they are in the liquid state. So if you put a solid into its corresponding liquid, it sinks. Water's boiling point is unusually high. Other compounds similar in weight to water have a much lower boiling point.

Explanation:

Answer 2

The unique properties of water ( a polar molecule, it is able to form multiple hydrogen bonds, which account for many of water's special properties. ... Because of their partial positive and negative charges, polar molecules such as water can attract each other) give it it's ability to occur in the three states of matter

Water is made up of two hydrogen (H) atoms and an oxygen (O) atom. And water is unique in that it is bipolar, where the molecule has a slightly positive charge on one side (where hydrogen atoms are attached), and slightly negative on the oxygen

Learn more:

https://brainly.com/question/8553690


Related Questions

SCIENCE- help me please I have to turn this in tonight PLEASE.............

Answers

Answer:

Yes,if it has a large mass it will have a large weight Awnser (2)

Accuracy is a measure of how close a value is to its true value. You can control accuracy by choosing the appropriate tool or instrument and using it carefully. How could the students in the following questions improve their accuracy? Tyrrell wanted to measure the growth of tomato plants in response to different types of fertilizer. Which tool would be most accurate?

Answers

Answer:Metric ruler

Explanation:

Answer:

1. Metric ruler

2. a pH meter can distinguish smaller differences in pH as compared to a pH strip.

Explanation:

Got those right on edge ;)

What does a targeted digestive capsule mean?

Answers

Targeted to help just that the (digestive system) a digestive capsule is a coated tablet that is digested

NEED HELP ASAP!!!!

In trying to prove continental drift, Alfred Wegener used evidence from long ago to show that in the distant past, similar animal species lived in places that are ______today. For example, fossils of the________ were found in India, Africa, and Antarctica.

Answers

Wegener used Gondwana glaciation evidence, lithological and structural evidence, plates fitting together, and paleontological evidence to prove his theory. 1) separated 2)  Lystrosaurus.

What evidence used Wegener to prove his theory?

Since Wegener’s theory about continental drift was seriously criticized, he used a list of 10 pieces of evidence proposed by the geologist Du Toit that supported his theory.

The list includes Gondwana glaciation evidence, lithological and structural evidence, plates fitting together, and paleontological evidence.

Among the paleontological evidence, plant and animal fossils from the same species were found in currently separated continents. This distribution suggests the existence of a big unique supercontinent where these species used to inhabit.

For instance,

Glossopteris (fern) impressions are widely distributed in determined areas of Africa, South America, India, and Australia.

Terrestrial vertebrate fossils also support the theory. The presence of Triassic tetrapods in all continents suggests terrestrial corridors between landmasses.

Lystrosaurus ⇒ Triassic reptile ⇒ Found in Africa, India, and Antarctica

⇒ Mesosaurus ⇒ Triassic reptile ⇒ Found in South America and Africa

⇒ Cygnonathus ⇒ Triassic reptile ⇒ Found in South America and Africa

Finding these fossils on current different continents suggests that these landmasses were once together, and these species used to live in the same region.

With time, continents diverged and got separated by the ocean. The region where these species used to live got divided and fossils got separated.

In trying to prove continental drift, Alfred Wegener used evidence from long ago to show that in the distant past, similar animal species lived in places that are _separated_today. For example, fossils of the_Lystrosaurus_ were found in India, Africa, and Antarctica.

1) Separated

2) Lystrosaurus

You can learn more about Wegener evidences at

https://brainly.com/question/839947

https://brainly.com/question/9444622

#SPJ1

Plz help I will mark you brainlist plz ​

Answers

Answer:

ISOTOPES

the same number of protons

but difference numbers of neutrons

IONS

because they have lost or gained one or more electrons

Answer:

atoms of the same element have same proton number but different nucleon number I hope this help u if u want more ask me

why did europeans want to conquer the new world ?

Answers

Answer:

Europeans wanted to explore the world so that they could gain wealth. European rulers fought many wars and they were very expensive so they needed to find gold, silver and precious stones to pay for them.

Explanation:

Phosphorus is mainly stored in the

Answers

Answer:

Phosphorus is mainly stored in the  soil and rocks in the form of phosphate.

Explanation:

i hope this helps

Why is it beneficial for the earth to have both autotrophic and hypertrophic?

Answers

Because it will create balance on the earth. For example if there are only autotrophs there will be competition for nutritious and space for the roots to grow .Also for the heterotrophs, the harbivous will be hard for them to find plants to eats eventually it will lead to starvation then death and their death will affect carnivores because the organisms that they used to hunt are all dead now. So when there is a balance between autotrophs and heterotrophs they will help each other to survive.

Are fungi Producers or Consumers?

Answers

Answer:

Bacteria and fungi are actually decomposers. They eat decaying matter - dead plants and animals and in the process they break them down and decompose them.

Fungi it’s a decomposer because it decomposes the bodies of dead plants and animals.

Charles Hillman, an associate professor at the University of Illinois, is conducting research into why children are better at problem-solving after exercise. He places 20 kids, approximately 10 years of age, on a treadmill for 20 minutes. Another group of 10-year-old kids sits in a chair for 20 minutes. Dr. Hillman then measures the brain wave activity of both groups. The group who exercised showed a 5% increase in the P3 waves, which occur during decision- making. What would need to be done in order to make this experimental outcome accepted in the scientific community? Group of answer choices More time would need to be allowed for the experiment. Other scientists would need to confirm the results by performing the same experiment. The same test would have to be done using a different type of exercise. Girls and boys would need to be tested separately and then together.

Answers

Answer:

Other scientists would need to confirm the results by performing the same experiment.

Explanation:

According to this question, an experiment was conducted by an associate professor, using 20kids, to discover why children are better at problem-solving after exercise. He arrived at a result that Children who exercised showed a 5% increase in the P3 waves, which occur during decision- making.

However, in order for this findings by Charles Hillman to be generally accepted and recognized in the scientific community, which is a connection of several scientists, the results need to be confirmed by performing the same tests or experiment.

Note that, an experiment becomes a scientific theory if it has undergone series of repeatable tests. One of the key features of scientific experiment is that it must be repeatable.

This is a timeline depicting the development of atomic ___________. What word should be used to fill in the blank? Support your choice with evidence. A) Law. At each interval on the timeline, scientists described the patterns they saw in both atomic and subatomic structure. Eliminate B) Law. Scientists used observation, experimentation, and mathematical models to explain atomic stricter and the behavior of subatomic particles. C) Hypothesis. Scientists conducted experiments at each interval. They made educated guesses regarding atomic structure and then experimented to support or rejected the hypotheses. D) Theory. At each interval on the timeline, scientists made observations and conducted experiments to explain how atoms and/or subatomic particles behaved in order to determine atomic structure.

Answers

Answer:

Subatomic particle, also called elementary particle, any of various self-contained units of matter or energy that are the fundamental constituents of all matter. Subatomic particles include electrons, the negatively charged, almost massless particles that nevertheless account for most of the size of the atom, and they include the heavier building blocks of the small but very dense nucleus of the atom, the positively charged protons and the electrically neutral neutrons. But these basic atomic components are by no means the only known subatomic particles. Protons and neutrons, for instance, are themselves made up of elementary particles called quarks, and the electron is only one member of a class of elementary

Explanation:

because it is

it's d lol

Theory. At each interval on the timeline, scientists made observations and conducted experiments to explain how atoms and/or subatomic particles behaved in order to determine atomic structure. Let's take one example: Rutherford's gold foil experiment. Based on observing the behavior of alpha particles directed at a gold foil screen, Rutherford determined that an atom consisted of mostly empty space, with all of its positive charge concentrated in its center in a very tiny volume, surrounded by a cloud of electrons. Yet, further experimentation eventually lead to another model and another theory of atomic structure.

3. Write the complimentary sequence of DNA for the following strand:
5'-AATTAGGAGCCCAGCTTTGCCGA-3'

Answers

The correct answer is TTAATCCTCGGGTCGAAACGGCT

This is because whenever you’re trying to find the complementary sequence of DNA, you basically switch which the listed base and it’s correspondent.

Adenine -> Thymine
Cytosine -> Guanine

Hope this helps!! :)

If a squirrel climbs a tree at 16m/s how many meters will it travel every hour ? ____ m/hr

Answers

Answer:

57600

Explanation:

16x60x60

Brainiest please :D

The distance travelled per hour by the squirrel as it climbs a tree at 16m/s is :  57600m/hr

Determine the distance travelled every hour

Given data :

velocity = 16m/s

To determine the distance travelled per hour

16 m * 60secs * 60 minutes

= 16 * 60 * 60

= 57600 m

Hence we can conclude that the The distance travelled per hour by the squirrel as it climbs a tree at 16m/s is :  57600m

Learn more about Velocity : https://brainly.com/question/4931057

#SPJ2

What kind of mineral ID is this?

please hurry !! thank you :)

Answers

Answer:

Cleavage and Fracture

Explanation:

Cleavage is the way a mineral breaks. Many minerals break along flat planes, or cleavages—some in only one direction (like mica), others in two directions (like feldspar), and some in three directions (like calcite) or more (like fluorite). Some minerals, like quartz, have no cleavage. Cleavage is a profound property that results from a mineral's molecular structure, and cleavage is present even when the mineral doesn't form good crystals. Cleavage can also be described as perfect, good or poor.

Which of the following could be a sequence in the carbon cycle?

Answers

Answer:

plants take in carbon dioxide and produce glucose --> animals consume plants --> animals break down glucose and release carbon dioxide

Explanation:

The carbon cycle is the sequence through which carbon is cycled through ecosystems. The carbon cycle usually occurs in the following order:

First, plants take in carbon dioxide and convert it to glucose.

Then, animals consume plants and break down glucose through the process of respiration.

Finally, this process releases carbon dioxide back into the atmosphere, and the cycle continues.

Who was the first person to see cells under the microscope and give them name a Robert Hooke b Theodor Schwann c Anton van Leeuwenhoek d Matthias Schleiden

Answers

Answer:

a) Robert Hooke

Explanation:

The cell was first discovered by Robert Hooke in 1665, which can be found to be described in his book Micrographia. In this book, he gave 60 'observations' in detail of various objects under a coarse, compound microscope.

The first person to observe the cell under the microscope is Robert Hooke, who is present in Option a. Robert Hooke is the person who first observed cork cells under the microscope and gave them a name. Option a is correct

What is a cell?

In the early stages of the earth, cells were not as developed as those of today's eukaryotes; they had RNA as genetic material, and later by evolution, today's eukaryotic cells developed. Those RNA-containing cells were extremely susceptible to mutation, whereas today's DNA-containing cells are not.

The eukaryotic cell contains numerous organelles that perform various functions, such as the lysosome, which degrades pathogens, the chloroplast of plants, which perform photosynthetic reactions, the nucleus of eukaryotic cells, which conserves DNA, and the mitochondria, which generate energy through cellular activities.

Hence, the first person to observe the cell under the microscope is Robert Hooke and gave them a name, who is present in Option a.

Learn more about the cell here.

https://brainly.com/question/12129097

#SPJ5

1. What makes water so unique?

Answers

Answer:

It is the reason the sky is blue

Explanation:

water helps you live, literally.

Commodity processors extract juice from oranges and
it in order to kill microbes and slow spoilage.

Answers

Answer:

Microbes

Explanation:

A student wants to create a liquid volcano. The student observes bubbles in the soft drink prior to opening it. The student first proceeds to open the soft drink bottle and place it on the floor. Next the student drops candy tablets into the drink using a rolled piece of paper, so that the tablets are able to fall into the drink continuously. The student notices a very powerful reaction as the drink fizzes and starts to bubble. In this scenario, what would be the catalyst ?

Answers

Answer: the candy tablets being added to the drink

Explanation: i’m on the test right now and that’s what seems more logical

Answer:

A student wants to create a liquid volcano. The student observes bubbles in the soft drink prior to opening it. The student first proceeds to open the soft drink bottle and place it on the floor. Next the student drops candy tablets into the drink using a rolled piece of paper, so that the tablets are able to fall into the drink continuously. The student notices a very powerful reaction as the drink fizzes and starts to bubble. In this scenario, what would be the catalyst ?

A: The candy tablets being added to the drink

organisms that have many characteristics in common are grouped into a _______?

Answers

Organisms that have many characteristics in common are grouped into a ’species’ - hope this helped :)

Answer:

The are grouped in species...

​Which of the following structures are found in eukaryotes, but not prokaryotes?

Choose 1 answer:

(Choice A) Golgi body

(Choice B) Cytosol

(Choice C) Cilia

(Choice D) Cell membrane

Answers

i’m pretty sure the answer is A

The structures that are found in eukaryotes, but not prokaryotes are:

Golgi bodyCilia. Both prokaryotic and eukaryotic cells contain cytosol and cell membrane structures.

The Golgi apparatus is known as a cellular organelle whose function is to handle the proteins synthesized by the endoplasmic reticulum.

It is found in eukaryotic cells and is responsible for completing the production process of certain proteins.

Cilia are a series of short and numerous mobile extensions of the plasma membrane that line the cell surface of some eukaryotic cells.

Prokaryotic cells form living unicellular organisms, they present their genetic material dispersed in the cytoplasm, because they lack a cell nucleus.

Its cell membrane is responsible for delimiting the organism, which also lacks any type of organelle or cell divisions.

Therefore, we can conclude that the structures that are found in eukaryotes, but not prokaryotes are: Golgi body and Cilia and both prokaryotic and eukaryotic cells contain cytosol and cell membrane structures ..

Learn more here: https://brainly.com/question/776836

Im crying because im so in a hurry help me fastas you can in this science question.

Answers

energy convention: Convection is the motion of a fluid driven by temperature differences across that fluid. When a fluid is heated, the region in closest contact with the heat source becomes less dense due to increased kinetic energy in the particles. Convection is one of the fundamental ways that heat is transferred

Plsss helppp plllsss helppp

Answers

Answer:

A

Explanation:

A solution with a pH lower that 7.0 is acidic, so that narrows the answers down to a and d. OH- is a base and H+ is acidic, so the answer is A

Answer:

I cant really read it, its kinda blurry.

Explanation:

Which organelles are found in plant cells but not in animal cells?

Answers

Answer:

Organelles that are found in plant cells, and not in animal cells, are chloroplasts, a call wall, specialized plastids, and a large central vacuole.

Hope you found this helpful <3

Answer:

cell wall and chloroplast

Explanation: hope this helps:)

Rice, wheat, soybeans, and _______ are considered the four angiosperms that are responsible for early agriculture.

Answers

Answer:

Corn

Explanation:

I'm not 100% sure so lmk ig I'm right or wrong

Answer:corn

Ethylene

dormant

anther

stigma

fruit

temperature

Wind pollination required a great deal of excess pollen, just so some of it lands, by chance, in the right place. Animal pollination is more selective because animals pick pollen up and carry it directly to where it needs to be. Although there is still a chance that the pollen will be from the wrong plant species, plants can manipulate variations in animal behavior through the structures of their flowers, the time and season of flowering, or the rewards or attractive chemicals they produce to narrow the field of pollinators, and increase the chances of having exactly the right pollen put in exactly the right place.

Explanation:

I will give brainliest!!!

You're looking through a microscope at a eukaryotic cell and notice that its genetic material (DNA) is openly floating around the cytosol.

What could be a possible cause for what you're seeing through the microscope?

Choose 1 answer:

(Choice A)
A
The lysosome is damaged.

(Choice B)
B
The nucleus is damaged.

(Choice C)
C
The vacuole is damaged.

(Choice D)
D
There is no cause; genetic material should be floating around the cell in this manner.

Answers

Answer:

B. The nucleus is damaged.

Explanation:

Eukaryotic cells contain a membrane-bound nucleus and numerous membrane-enclosed organelles. DNA is present in the nucleus of the cell. If the nuclear membrane is ruptured/damaged then the nucleoplasm along with the DNA will openly float around the cytosol.

Answer: The nucleus is damaged.

Explanation: The nucleus is supposed to keep genetic material (DNA) housed within its membrane-bound structure, but in this cell, the genetic material is openly floating around the cell's cytosol. Have a nice day :)

what is the role of rabbit in food chain ?​

Answers

Answer:

Rabbits are herbivores

Explanation:

Rabbit are herbivorous and directly depends on the green plants generally grasses for supply of food and energy. It is found at the second position in the foodchain. We can say that the rabbit is primary consumer in food chain. It is also link between the foodchain of grassland and forest.

Answer:

The controller that keeps plant life in check

Explanation:

Describe a non-biological hierarchy that exists in everyday life and how it relates to a biological system.


Answers

Answer:

A non-biological hierarchy could be the way the military is organized, with the soldiers at the very bottom and the big commanders on top. (I don't know the specific names for each of them) This relates to a biological heirarchy since the smaller, sadly less important things are at the bottom, like atoms and soldiers, and each group of soldiers makes a regiment (which would be a molecule), then a battalion (which would be a cell), then so on. (I dont know the order of the groups but you can look it up)

Which of the following is a function of proteins? (AKS 1a)
O A.
A. long term energy storage
O
B. help with slowing down chemical reactions
O
C. build tissues such as bone and muscle
O
D. raise activation energy and lower reaction rate

Answers

Answer:

ans is A long term energy

storage

Long term energy storage

I will give brainliest!!!!!!!
Protein synthesis can occur on the rough endoplasmic reticulum (ER) but not on the smooth ER.

Which cell structures are attached to the surface of the rough ER that allow it to make proteins?

Choose 1 answer:

A
DNA strands

(Choice B)
B
Vacuoles

(Choice C)
C
Chloroplasts
(Choice D)
D
Ribosomes

Answers

Answer:

The answer is b

Other Questions
Which of the following is true of qualitative research? Questions vary in order and phrasing from group to group and interview to interview. The main techniques used for gathering data are surveys and experiments. During an interview, the interviewer should not improvise. Many interviews should be conducted in order to give a projectable scientific sample. Interviewers need only be able to read scripts. What is the inverse of the function h(x) =3/2(x-11) Need help please and other questions What is a republic?*O a government in which citizens elect leaders who make government decisionsa government in which citizens rule directly and not through representativesa government in which one person rulesa government in which the noble class rulesWhich Enlightenment thinker believed that all human beings had a right to life, What details does the speaker use to contrast life in her fathers original culture and life in the city? What tone is used to describe these two settings? without title What is the primary source of energy for food chains in an ecosystem? decomposers producers consumers the sun 3. Serving as the chapter photographer is the duty of which officer position? Which scenario could be represented by the algebraic expression n minus 13? A) Ariel wants to find the difference of a number and 13. B) Ariel wants to find the product of 13 and a number. C) Ariel wants to find the sum of a number and 13. D) Ariel wants to find the difference of 13 and a number. The area of a square is numerically 60 morethan the perimeter. Find the length of the side.A) 200 units B) 10 unitsC) 50 units D) 40 unitsStep by Step for this please.Thank you, have a nice day. Which legally required form divulges information about financial advisors?a. Form DAVb. Form AVDC.Form ADVd. Form DVA PLEASE HELP ME ILL GIVE YOU BRAINLIEST PLUS 20 POINTS BUT IT HAS TO BE CORRECT. g(x)=square root sign x+3 chargedparticles in thethat have a mass ofAMU.The number of protons determinestheof an atomFor example hydrogen hashelium has I need answers for multiple assments Milden Company is a merchandiser that plans to sell 43,000 units during the next quarter at a selling price of $60 per unit. The company also gathered the following cost estimates for the next quarter: Cost Cost Formula Cost of good sold $31 per unit sold Advertising expense $187,000 per quarter Sales commissions 6% of sales Shipping expense $45,000 per quarter + $4.00 per unit sold Administrative salaries $97,000 per quarter Insurance expense $10,700 per quarter Depreciation expense $67,000 per quarter Required: 1. Prepare a contribution format income statement for the next quarter. 2. Prepare a traditional format income statement for the next quarter. In 2020, Halloween is on a Saturday. Record the day of the week for Halloween in:2021: 2022: 2023: 2024: 2025: 2026: 2027: 2028: 2029: 2030: Identify the structures labeled in the diagram, Label B ribosomes lysosomes vacuoles what is 2 x d x 5 x d x d x 5 Why are the following expressions notmonomials?3xy^Z1-2s(ab)^1/2 Please help Giving 100 points extra And brainliest Which number is irrational?3-27/325/9pi/3274.12