If [tex]g(x) = x^{2} - x[/tex], find the value of [tex]g(-1)+4[/tex]

Answers

Answer 1
The answer is 6
g (-1) + 4 = 6
Answer 2
The answer is -g+4 mark me brainliest

Related Questions

The following table represents a linear function. Use the table to find the slope and y-intercept. To earn full credit, show your work using a method explained in the Orientation. HELP ASAP PLEASE

Answers

The answer is:
Y = 7
X = 1
The answer is
Y=7
X=1

If the amount of white sugar were increased by a factor of 2 1/2, in cups how much white sugar would there be

Answers

Answer: Multiply the initial amount of white sugar by 5/2

Step-by-step explanation:

It is 5 5/8 because you have to change them both into improper fractions so 2 1/2 turns into 5/2 and 2 1/4 changes to 9/4 so you have 5/2 * 9/4 but you need to be able to multiply them so the 5/2 changes to 10/4 so 9/4 * 10/4 = 5 5/8 :) 

Write the equation of the line that passes through the given point and is perpendicular to the given line.

Answers

Answer:

23.

Step-by-step explanation:

It’s number 23 use a calculator

We know that the charge on the left is positive and the charge on the right is negative because

A the definition for the direction of an electric field line is toward positve charges.the definition for the direction of an electric field line is toward positve charges.
B the definition for the direction of an electric field line is the way a positive test charge would move.the definition for the direction of an electric field line is the way a positive test charge would move.
C the definition for the direction of an electric field line is toward the stronger charge.the definition for the direction of an electric field line is toward the stronger charge.
D the definition for the direction of an electric field line is the way a negative test charge would move.

Answers

Answer:
B) the definition for the direction of an electric field line is the way a positive test charge would move.

The definition for the direction of an electric field line is the way a positive test charge would move. Option B is correct.

What is the charge?

When placed in an electromagnetic field, the physical attribute of matter known as electric charge causes it to experience a force. Positive and negative electric charges are the two types of charges that charge carriers, protons, and electrons, frequently carry. The movement of charges produces energy.

here,
Because the definition for the direction of an electric field line is the way a positive test charge moves, the charge on the left is positive and the charge on the right is negative.

Thus, the direction of an electric field line is defined as the movement of a positive test charge. Option B is the right answer.

Learn more about the charge here:

https://brainly.com/question/27171238
#SPJ2

PLEASE HELP ME!!!!!!!!!!!!!!

Answers

Answer:

9

Step-by-step explanation:

triangle is a right angle triangle, using pythagoras theorem

15^2 − 12^2 = 81

[tex]\sqrt{81} =9[/tex]

First person is right

Answer:

9

Step-by-step explanation:

triangle is a right angle triangle, using Pythagoras theorem

15^2 − 12^2 = 81

Square root of 81 is 9

PLEASE HELP NEEDED!!!!
Match the following equation to the correct situation.
40%(b + $18.00) = 40%(b) + $7.20
A.
Shawn owed 40% of his tuition bill, b, after paying $7.20.

B.
Summer paid $7.20 more than 40% of b.

C.
The cost for a coat was 40% of the sum of b and $7.20.

D.
A school received a donation that was 40% more than $7.20.

Answers

The answer to the question is c
The answer is going to be D

A circle has a radius of 20 cm. What is the exact area of
the circle?

Answers

Answer:1256.64cm²

Step-by-step explanation:

What the person said above me

43.
Referring to the figure, out of 2500 people, how many would you
expect check email daily?
a. 575 people c. 190 people
b. 1900 people d. 25 people

Answers

Answer:

B.) 1900 people

76% of 2500 is 1900

23% of 2500 is 575

1% of 2500 is  25

Have a nice day!

You would expect 1900 people to check email daily. The correct answer is b.

What is a percentage?

A ratio or value that may be stated as a fraction of 100 is called a percentage. And it is represented by the symbol '%'.

Given;

Number of people = 2500

And from the chart,

76% of people check email daily.

To find the number of people:

use percentage formula,

number of people = 76% of 2500

Number of people = 76 x 2500 / 100

Number of people = 1900

Therefore, 1900 people check email daily.

To learn more about the percentage;

https://brainly.com/question/24159063

#SPJ2

Which algebraic expression is a translation of the expression "twice n subtracted from m"?A.m – 2nB.2n – mC.m – nD.n – m please hurry

Answers

Answer:

Step-by-step explanation:

A

Answer: its A its the awnser A.

What is 2x^20 simplified

Answers

Answer:

2x^20 is already simplified

Step-by-step explanation:

Answer:

No Solution

Step-by-step explanation:

It is impossible to simplify further!

DNE

Shirley sold 60 kilograms of grapes on Friday, sold twice as much on Saturday and sold 30 more kilograms on Sunday than the combined sales on Friday and Saturday, How many kilograms did she sell in all? Please answer with EXPLANATION.

Answers

Answer: 390 i guess...

Step-by-step explanation:

60+(60x2)+((60+120)+30)

add on Friday sales to two times of Friday as Saturday, then combine Saturday and Friday, add 30 to the combined sales, thats how

60+ (60•2) = 180
180+30= 210
210+180= 390

Use Structure
An artist is drawing up plans for a mural. She wants to include a rectangle in her design.

Answers

Answer:

do you still need help?

Step-by-step explanation:

Answer:

are those the only options?

Step-by-step explanation:

(please add explanation)
Referring to the figure, what is the area of the trapezoid shown?
a. 114 in2 c. 528 in2
b. 15.5 in2 d. 228 in2

Answers

Answer: a

because 11+8 is 19x 12 is 228/2 is 114

Answer: A.

Step-by-step explanation:

A=a+b over 2 times h is the formula for this problem

Plugging in the numbers you get the formula 8+11/2 times 12

8+11= 19

19/2=9.5

9.5 times 12 is 114

your answer is 114 in so A.

 

Write the equation of the line that passes through the given point and is parallel to the given line.

Use the slopes of lines A and B to show that they are perpendicular to each other.

Answers

Answer:

pata nahi bhai kyon Brainly kaam karna band kar diya hai

Step-by-step explanation:

A according B and cross by 972

Referring to the Fig. in Question #30, you are a reporter for this school's
paper. Using the mode value, how would you summarize the data for Rai?
a. Rai had one mode, 2, which indicates most judges thought she was
an average performer.
b. Rai had two modes, 1 and 3, which indicates that some judges
really liked her and others didn't like her much at all.
c. Rai didn't have a mode, which indicates the judges' opinions
were very scattered about her.
d. Rai had three modes, 1, 2 and 3, which indicates the judges'
opinions were fairly spread out.

Answers

Answer:

Step-by-step explanation:The answer is A

Answer: a.

Step-by-step explanation:

Higher Order Thinking: Chef Morgan's
restaurant has 24 tables. Fifteen of the
tables each have one flower in a vase.
The remaining tables have 5 flowers in
each vase. How many flowers are there?
Show how you found the answer.

Answers

⬇️—Answer—⬇️

60 flowers in Chef Morgan’s Restaurant.

⬇️—Solutions (with-steps)—⬇️

We are given the following information :

1) The restaurant has 24 tables.

2) 15 of those tables have 1 flower in each vase.

3) The remaining have 5 flowers

15 of her tables + her remaining tables = 24 of her total tables.

This means, 15 of her tables have one flower in each vase while she has 9 tables which are remaining containing 5 flowers in their vases.

In mathematics each usually means to multiply something. So,

15 x 1 = 15

9 x 5 = 45

15 + 45 = 60

So, there are 60 flowers in total.

To check our answer:

(15 x 1) + (9x5) = 60

Have a wonderful day! :D

Answer: 60 flowers

so 24 tables in total

15 tables have 1 flower= 15 flowers

the other tables have 5 flowers

24 total tables subtract the 15 tables with a flower already= 9 tables

5 flowers for the 9 tables remaining each=45

45 flowers from remaking table + 15 flowers from tables with 1 flower= 60 flowers

hope this helped!

The product of a number and 7, increased by three

pls help meeee

Answers

since they ask for the product you are multiplying y times 7. Then + 3 to the answer and u get 7x+3

help
What values of x and y satisfy the system {y=−2x+3y=5x−4?
Enter your answer as an ordered pair, like this: (42, 53)
If your answer includes one or more fractions, use the / symbol to separate numerators and denominators. For example, if your answer is (4253,6475), enter it like this: (42/53, 64/75)
If there is no solution, enter "no"; if there are infinitely many solutions, enter "inf."

Answers

There is no solution for this answer
the answe is 3457……..74848485956969699696

Beth sells roses and petunias. The expression 3r + 2.5p gives the cost (in dollars) of r roses and p petunias.

What is the cost of 7 roses and 8 petunias?


$39


$15


$41


$22

Answers

it would be $41 your welcome
3(7)+2.5(8)
The answer is 41

Four brothers have ages that are consecutive even integers. From youngest to oldest, their names are Matt, Pat, Dave, and Dan. If Dan's age is 36 years less than twice Pat's age, then what are the ages of all four brothers?

Answers

Answer:

Matt - 38, Pat - 40, Dave - 42 and Dan - 44

Step-by-step explanation:

Lets take Matt's age as x, Pat's age as x + 2, Dave's age as x + 4 and Dan's age as x + 6.

Given, Dan's age is 36 years less than twice Pat's age

Equation:

x+6 = 2(x+2) - 36

= x+6 = 2x + 4 - 36

= x+6 = 2x - 32

= 6+32 = 2x - x

= x = 38

Matt - x = 38

Pat - x+2 = 40

Dave - x+4 = 42

Dan - x+6 = 44

Answer:

Matt = 38, Pat = 40, Dave = 42, Dan = 44

Step-by-step explanation:

Say Matt is x. We already know that Dan's age is 36 less than twice Pat's age so it is written like 2(x + 2) - 36 = x + 6

Simplify to 2x + 4 - 36 = x + 6

Simplify more to x = 38

That means Matt is 38 years old. Since they are consecutive even numbers, then Pat's age is 40, Dave's age is 42, and Dan's age is 44.

Use the graph to determine the end behavior for the linear function. HELP ASAP PLEASE

Answers

I believe the answer you have selected is correct.

Answer:

You have the correct answer.

"as x goes to -infinity the graph decreases

as x goes to infinity the graph increases"

Step-by-step explanation:

use the table to preict the number of times you will spin 6 when you spin the spinner 100 times numbers spun: 1, 2, 3, 4, 5, 6 Times spun: 8, 6, 11, 7, 9, 9. you can predict that you will spin 6 ? times

Answers

Answer:

1/6% chance

Step-by-step explanation:

because you rolled 6 times and got six 1 time.

Answer:

1/6

Step-by-step explanation:

6

If Point B(-3, -6) is translated right 5 units, then rotated 180˚, what are the coordinates of B'?

Answers

Answer: (-2, 6)

Step-by-step explanation:

(-2,6)



Step by step explanation:

The equation y = −3x + 7 represents the amount of water y left in a 7-gallon tub after x minutes.
(PART A)
Where does the graph of the equation intersect the y-axis and the x-axis?
y-axis: (_, _)
x-axis: (_/_, _)
(PART B)
What do these points represent?
At ___ minutes, the tub has ___ gallons of water.
The tub is empty at _/_ minutes.

Answers

The amount of water in the tank y after x minutes, y = -3•x + 7, gives;

Part A: The points the graph intersects the y–axis is (0, 7)

The points the graph intersects the x–axis is (7/3, 0)

Part B; At zero minutes, the tub has seven gallons of water.

The tub is empty after 7/3 minutes

How can the amount of water in the tub be evaluated?

The given equation that gives the amount of water, y, left after x minutes is presented as follows;

y = -3•x + 7

Part A; The location where the graph intersect the y-axis, the y-intercept is found as follows;

At the y-intercept, x = 0, which gives;

y = -3×0 + 7 = 7

The point the equation intersect the y-axis is therefore;

(0, 7)

The location where the graph intersect the x-axis, which is the x–intercept is given by the point where y = 0, which gives;

y = -3•x + 7

0 = -3•x + 7

x = 7/3

The point the graph intersects the x-axis is the point;

(7/3, 0)

Part B;

The meaning of the points are expressed as follows;

(0, 7), the y-intercept, the point the graph intersects the y–axis, gives the amount of water in the tub at the start of the measurement.

Which gives;

At zero minutes, the tub has seven gallons of water.

The point the graph intersects the x–axis, the x–intercept represents the time at which the tub becomes empty.

Which gives;

The tub is empty after 7/3 minutes

Learn more about linear equations in mathematics here:

https://brainly.com/question/13738662

#SPJ1

Answer: Person is right look up of me to find good explanation

Step-by-step explanation:

WORTH 50 POINTSSSSSSSSSSSSSSSSS What number comes after 20, 33, and 50?

Answers

Answer:63

Step-by-step explanation:

i just added 13

Answer:

Step-by-step explanation: 21 22 23 24 25 26 27 28 29 30 31 32  34 35 36 37 38 39 40 41 42  43 44 45 46 47 48 49 51 52 53 54 55 56 57 58 59 60

(x^-2)^3 Simplify & express answers using positive exponents

Answers

Answer: 1/(x^6)

Step-by-step explanation:

(x^-2)^3=

(x^(-2*3))=

(x^(-6))=1/(x^6)

Answer:

1/[tex]x^{6}[/tex]

Step-by-step explanation:

(x^-2)^3

If you have parentheses around an exponent, you multiply them together.

x^-6

Change it to reciprocal so it is 1/[tex]x^{6}[/tex]

Proof:

[tex]x^{-2}[/tex] × [tex]x^{-2}[/tex] × [tex]x^{-2}[/tex] = [tex]x^{-2 - 2 - 2}[/tex] = [tex]x^{-6}[/tex]

Simplify the expression: -12/3(-8+(-4)^2-61+2

word version:
-12 divided by 3 (-8 plus -4) to the power of 2) subtract 61 add 2

I need a step-by-step explanation of how to solve this. I have tried multiple times and I can't get it right.

Answers

Answer:

Step-by-step explanation: 4 1/7 + 2 1/3 - 3/4 = 481/

84

= 5 61/

84

≅ 5.7261905

Answer:

Step-by-step explanation: 4 1/7 + 2 1/3 - 3/4 = 481/

84

= 5 61/

84

≅ 5.7261905

Step-by-step explanation:

George said
that 6 × 103 is 180. Do you agree or
disagree? If you disagree, explain the
mistake that he made and find the
correct answer.

Answers

6x103=618 , George is incorrect due to how he solved this.
6 times 103 is 618 so george is wrong george has not done his multiplication properly

PLEASE HELP ME!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

20 units

Step-by-step explanation:

(16, 0), (0, 12)

(x₁, y₁)   (x₂, y₂)

d = √(x₂ - x₁)² + (y₂ - y₁)²

d = √(0 - 16)² + (12 - 0)²

d = √(-16)² + (12)²

d = √(-16)² + (12)²

d = √256 + 144

d = √400

d = 20

I hope this helps!

Answer:

Step-by-step explanation:

Does anyone mind helping me with the second one? I was absent for a week and have to get caught up. This is 8th grade math please help!

Answers

Answer: The answer for Part A would be (-3,2)

Step-by-step explanation: I translated 8 units which leads to -2 and one unit to the left which gave (-3,2)

A. (-4,2) B. (-2, -6)
Explanation: on the rotate part 180 is basically just a reflection. If u get it wrong then blame ur teacher for not putting clock wise or counter clock wise
Other Questions
seven caculators cost $170.00 According to the data presented in the map, which of the following conclusions can be drawn about the population distribution in Pakistan? Pakistan has a low physiological density. Arithmetic density is highest in major cities. Agricultural density is highest in the southwest region. Population density is concentrated in mountainous regions. Physiological density is highest in the northeast. Describe the nucleus in a eukaryotic cell. An inductor is connected to an ac supply. increasing the frequency of the supply _________ the current through the inductor. Explain why you need to vertically align the decimal points when summing decimal numbers. At the north campus of a performing arts school, 30% of the students are music majors. At the south campus, 80% of the students are music majors. The campuses are merged into one eastcampus. If 65% of the 1000 students at the east campus are music majors, how many students did each of the north and south campuses have before the merger? Which functional group, if found in the r group of an amino acid, would most likely be able to form an ionic bond force with a charged amino group on another molecule?. Determine whether the events are mutually exclusive or not mutually exclusive. Then find the probability. Round to the nearest tenth of a percent, if necessary.drawing an ace or a heart from a standard deck of 52 cards For a second order reaction, the initial reactant concentration, [a]o, is 0.93 m. after 16.7 s, the concentration is 0.65 m. what is [a] after 84 s? Place these words in the correct order based onthe most gravity to the least gravity.UniverseMoonPlanetGalaxyStar Juan's professor lectures on the fact that certain features in animals have been passed down from one generation to another. what theory is juan's professor probably describing? If you have three junit test methods written in the same testing class and the first one fails its assertions, will he other methods still be executed? A bakery is making whole-wheat bread and apple bran muffins. for each batch of break they make $35 profit. for each batch of muffins, they make $10 profit. the break takes 4 hours to prepare and 1 hour to back. the muffins take 0.5 hours to prepare and 0.5 hours to bake. the maximum preparation time available is 16 hours. the maximum bake time available is 10 hours. let x = Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA In civil rights literature, which ideology was often at odds with multiculturalism? A. Disillusionment B. Symbolism C. Disenfranchisement D. Black Power Based on what you know of the peptide bonds that link together amino acid residues, why would proline's side chain reduce the flexibility of the backbone? What are "affiliates" asKing uses the word?Consider the context of how the word is used multiple times in paragraph 2. The frequency of a microwave signal is 9.76 ghz. what is its wavelength in meters? help me asap im in a dba back to basics exam and didnt study Imagine that an employer purchases a health insurance plan that costs $365 per month, but requires that the employee pay $35 per month toward the cost of the plan. If the employee's salary is