In the citric acid cycle, the acetyl group is removed from acetyl coa and attached to oxaloacetate to form Citrate
What is citric acid cycle ?The Krebs or citric acid cycle, also referred to as the tricarboxylic acid (TCA) cycle, is the primary source of energy for cells and a critical step in aerobic respiration. The cycle converts the acetyl coenzyme A (acetyl CoA) chemical energy into nicotinamide adenine dinucleotide (NAD)'s reducing power.
The final common oxidative pathway for carbohydrates, fats, and amino acids is the citric acid cycle. It is the most significant metabolic pathway for the body's energy supply. The most significant central pathway bridging almost all of the individual metabolic pathways is TCA.Learn more about Citric acid cycle here:
https://brainly.com/question/14900762
#SPJ4
Which choice identifies the flow of information according to the central dogma of molecular biology?.
The central dogma of molecular biology the information flows from genes (DNA) to mRNA to proteins (amino acids).
What is central dogma?The term Central Dogma has been defined as the term that refers to the two step process through which information flows from the sequence of DNA into a sequence of RNA (the process of transcription) and finally takes the form of proteins (the process of translation).
This is the process that ensures that genetic information of all living organisms is preserved and transmitted without any alteration or changes into their offspring and Francis Crick was the first scientist who proposed the term of "Central Dogma".
Therefore, The central dogma of molecular biology the information flows from genes (DNA) to mRNA to proteins (amino acids).
Learn more about molecular biology on:
https://brainly.com/question/19138651
#SPJ1
Which hormones help the body resist stress and make stored nutrients available to prepare the body for action?.
The hormone that helps the body resist stress and makes stored nutrients available to prepare the body for action would be Cortisol.
The main stress hormone, cortisol, elevates blood sugar (glucose), improves the brain's utilization of glucose, and increases the availability of substances that repair tissues. Furthermore, cortisol inhibits activities that, in a fight-or-flight scenario, would be unnecessary or harmful. Your kidneys' endocrine glands, the adrenal glands, produce and release the steroid hormone cortisol. Your body's response to stress is the primary aspect of cortisol's influence on your body.
Since it plays a role in how the body reacts to stress, cortisol is frequently referred to as the stress hormone. Blood pressure and immune responses are all increased, along with blood sugar and sugar levels. produced by the pituitary and hypothalamus in response to intense physical activity, excitement, and orgasm, and has analgesic properties.
Learn to know more about Stress on
https://brainly.com/question/18339187
#SPJ4
what is the probability that these two individuals will produce an offspring having the dominant phenotype with respect to all 7 traits?
An organism needs one or more copies of the dominant allele A and one or more copies of dominant for all four qualities to be dominant.
How likely is it that the children will exhibit the dominant phenotype?a homozygous parent with one
All of the kids will have the same phenotype of the dominant characteristic if the homozygous parent carries both of the aforementioned dominant alleles. To put it another way, there is a 100% chance that a child born from such a pairing will display the dominant phenotype.
How can you calculate the likelihood of having children?Only when both the mother and the father contribute an a gamete may an aa individual be produced. The likelihood of each parent producing a gamete is 50%. The likelihood of having an offspring with the gene aa is therefore (probability of mother contributing a) x (probability of father contributing a) = (1/2) (1/2) = 1/4.
To know more about dominant phenotype visit:-
https://brainly.com/question/25332551
#SPJ4
please help with this question
predict the effect on short-term atp production when resveratrol-treated mammalian muscle cells are grown in a culture medium that lacks glucose or other sugars.
The impact of resveratrol treatment on mammalian muscle cells' short-term atp synthesis • No ATP synthesis; reduced ATP synthesis
The quantity of energy released during aerobic respiration is a significant benefit. Only two pyruvate molecules (ATP) can be produced from glucose by organisms in the absence of oxygen.In the presence of oxygen, organisms may convert glucose into carbon dioxide. The rate declines as the product to substrate ratio rises. Your respiratory and circulatory systems are unable to deliver oxygen to the muscle cells quickly enough to sustain aerobic respiration during these intervals. This is especially true for the muscles in your legs. Your muscle cells employ the lactic acid fermentation process to enable the ongoing generation of some ATP synthesis.
Learn more about ATP
https://brainly.com/question/14637256
#SPJ4
Mark places some cells from an onion skin on a microscope slide. He uses a freshwater solution to make the wet-mound slide. When he observes the cells under the microscope for an extended period of time, what is he most likely to see?.
When he observes the cells under the microscope for an extended period of time, The cells have dissolved, destroying the cell walls.
What is microscope ?A microscope is a instrument used to examine objects too small to be seen with the eye. Microscopy is the science of examining small objects and structures with a microscope.Microscopic means invisible without the assistance of a microscope. A microscope is an instrument utilized to magnify small objects. Some microscopes can also be used to view objects at the cellular level, allowing scientists to see the shape of cells, their nuclei, mitochondria, and other organelles. A microscope is a device that allows people to see very small things that their eyes cannot see. Microscopes use glasses or magnifying glass-like lenses to make things appear larger.To learn more about microscope from the given link :
https://brainly.com/question/18661784
#SPJ4
the hydrologic cycle distributes water across the globe. which part of the hydrologic cycle refers to the water vapor released by plants?
The part of the hydrological cycle that deals with the water vapor released by plants is called transpiration.
What is transpiration?The hydrological cycle tells us about the process in which water passes through different compartments around the hydrosphere. The transpiration of plants is when they are going to lose water in the form of steam, this water is what the plant is not going to use and it also cools it since this steam is generated when there are high temperatures
The water will be released through the stoma which are small microscopic pores.
Therefore, we can confirm that the part of the hydrological cycle that deals with the water vapor released by plants is called transpiration.
To learn more about transpiration visit: https://brainly.com/question/13891305
#SPJ1
In the control sample histogram, does the population of cells in the s phase show a distinct peak? why or why not?.
No, as the S phase develops, the amount of DNA in each cell fluctuates, resulting in a variety of fluorescence intensities in the S phase cells.
A normal diploid somatic cell starts the S phase with a 2N complement of DNA and ends it with a 4N complement of DNA. The S phase is a time of extensive DNA synthesis during which the cell repeats its genetic material.
DNA synthesis or replication takes place during the S phase of a cell cycle, which happens during interphase and comes before mitosis or meiosis. By doing this, a cell's genetic material doubles before it begins mitosis or meiosis, providing enough DNA for the cell to divide into daughter cells.
To learn more about DNA
https://brainly.com/question/28481425
#SPJ4
Demethylation and acetylation lead to an open chromatin structure and are associated with ________regions of genomes.
Demethylation and acetylation lead to an open chromatin structure and are associated with euchromatic regions of genomes.
What is chromatin?
The term "chromatin" refers to a compound of DNA and proteins that makes up the chromosomes found in the cells of higher creatures like humans. The enormous amount of DNA in a genome is packaged by many proteins, most notably histones, into a shape that can fit inside the cell nucleus.
Long DNA molecules are bundled into smaller, denser structures as the main purpose.
Therefore, Demethylation and acetylation lead to an open chromatin structure and are associated with euchromatic regions of genomes.
To learn more about chromatin
Here: https://brainly.com/question/29310028
#SPJ4
What is the best evidence that all life evolved from prokaryotic rather than eukaryotic ancestors?.
Best evidence that all life evolved from prokaryotic rather than eukaryotic ancestors is : the oldest fossil form of life known is prokaryotic.
How can you say that life evolved from prokaryotic ancestors ?The evidence that show that life evolved from prokaryotic ancestors is that the oldest fossils found are prokaryotes. The oldest bacterial fossils is of about 3.5 billion years ago whereas the oldest eukaryotes discovered are about 2.1 billion years old.
Microbial mats or large biofilms represent the earliest forms of prokaryotic life on Earth.
The hypothesis is that eukaryotic cells evolved from a symbiotic association of prokaryotes which is called endosymbiosis. It is well supported by studies of mitochondria and chloroplasts, which are thought to have evolved from bacteria residing in large cells.
To know more about evolution, refer
https://brainly.com/question/12271572
#SPJ4
Recent evidence suggests that the __________ plays a particularly central role in the modulation of emotion.
Recent evidence suggests that the amygdala plays a particularly central role in the modulation of emotion.
The amygdala is widely thought to be the neural system's core for processing fearful and threatening stimuli, including threat detection and activation of appropriate fear-related behaviors in response to threatening or dangerous stimuli. The amygdala is in charge of processing strong emotions like fear, pleasure, or anger. It may also send signals to the cerebral cortex, which is in charge of conscious thought. Physical reactions are controlled by signals sent from the thalamus to the autonomic nervous system and skeletal muscles.
The amygdala's primary function is to regulate emotions such as fear and aggression. The amygdala is also involved in associating emotional meaning to memories, Decision-making and reward processing.
To learn more about amygdala, here
https://brainly.com/question/9888781
#SPJ4
What causes convection in the mantle quizlet?.
Internal heating from the decay of radioactive isotopes of uranium, thorium, and potassium, as well as long-term secular cooling of the earth and heat from the core, are the primary sources of thermal energy for mantle convection.
The movement of the mantle as it transfers heat from the white-hot core to the brittle lithosphere is described as mantle convection. The mantle is heated from below and cooled from above, and its overall temperature drops over time. All of these factors play a role in mantle convection.
Mantle convection is the slow creeping motion of the Earth's solid silicate mantle as convection currents transport heat from the interior to the planet's surface. The lithosphere of the Earth's surface sits on top of the asthenosphere, and the two make up the upper mantle. Hot rocks advect heat upward, while cold rocks advect cold downward; this counterflow is equivalent to an upward heat flux.
To learn more about convection in the mantle, here
https://brainly.com/question/12265809
#SPJ4
2.the nutrients in foods perform functions in the body, what are they and briefly describe the nutrients (from above) involved in these functions?
Carbohydrates, lipids, proteins, vitamins, and minerals are just a few of the different types of nutrients found in food.
The body's main source of energy is carbohydrates. Per gram, they offer roughly 4kcal.
Proteins are essential for the structure, operation, control, and repair of the body's tissues and organs since they carry out the majority of the work in cells. They also support our body's ability to fight off diseases. They support the growth of muscles, hair, and nails.
Fats: Fats give the body energy. Each gram of fat has more than twice as many calories as a gram of protein or carbohydrate (9 kcal per gram).
Vitamins: Vitamins assist in controlling bodily chemical processes. They aid in warding off infections and keeping our bodies healthy.
Minerals: Minerals are nutritional ingredients that are essential to numerous bodily processes. They are necessary for the body's healthy development and upkeep.
Learn more about to nutrients visit here: https://brainly.com/question/1268939
#SPJ4
during transcription, the enzyme complex known as creates an rna molecule by joining nucleotides complementary to a dna template.
In order to decode the genetic code of a cell, transcription is the initial step. RNA polymerases, a class of enzymes involved in transcription, create complementary RNA molecules to a section of one strand of DNA during the transcription process.
When transcription is taking place, what enzyme creates the complementary RNA strand?The RNA polymerase
RNA polymerase, the primary enzyme responsible for transcription, builds a complementary strand of RNA using a template made of single-stranded DNA. A new nucleotide is added to the 3' end of an RNA strand as it is constructed by RNA polymerase, specifically in the 5' to 3' direction.
The enzyme that is utilize during transcription is what?The RNA polymeraseRNA polymerase, an enzyme, and many supporting proteins known as transcription factors are responsible for carrying out transcription.
To know more about transcription visit:-
https://brainly.com/question/14136689
#SPJ4
What phase of the cell cycle are chromosome pairs separated by the retraction of spindle fibers?.
The phase of the cell that chromosome pairs separate by retraction of spindle fibers is anaphase.
During anaphase, sister chromatids are separated simultaneously at the centromere. Separated chromosomes are pulled to opposite poles of the cell by the mitotic spindle. In anaphase, each daughter cell ensures that it receives an identical set of chromosomes. the stage is marked by the splitting of centromeres as well as the segregation of chromatids
The stage occurs in both meiosis and mitosis where it takes place before metaphase
In metaphase, the cell's nucleus collapses and the cell's chromosomes condense and move together, aligning them to the center of the dividing cell the process of metaphase prepares for anaphase.
To learn more see https://brainly.com/question/29360563?referrer=searchResults
#SJP4
Do you think risk assessment would be a better strategy for a prey animal than frequent vigilance? explain your reasoning.
In general, risk assessment would be preferable than constant vigilance for a prey animal.
What are the tactics used by predators to capture their prey?Under the pressure of natural selection, predators have developed a variety of physical adaptations for locating, catching, killing, and digesting prey. These consist of swiftness, dexterity, stealth, keen senses, teeth, claws, filters, and adequate digestive systems.
What does animal behavior mean by vigilance?Animals that have evolved vigilance behaviors keep an eye out for potential hazards in their environment (Quenette, 1990; Treves, 2000; Beauchamp, 2015).
In general, risk assessment would be preferable than constant vigilance for a prey animal. The prey would be aware of their surroundings and search for signs of potential harm, such as the presence of a predator.
To know more about prey animal visit:-
https://brainly.com/question/813932
#SPJ4
Describe an adaptation that the sea spider has for gathering food and conserving energy.
a. Gathering Food -
b. Conserving Energy -
An adaptation that the sea spider has for gathering food and conserving energy Gathering Food. Option A.
Many spider crabs have colors and patterns that match the algae and other organisms on the sea floor. Some have bright colors to ward off predators. They use a tubular proboscis to capture food or feed on microbes. Spider crabs reproduce by forming mating groups in which males collect and fertilize eggs from females.
The father then takes care of the eggs and offspring. Spider crabs are a widespread and phylogenetically important group of marine arthropods. As the spider grows, its skin becomes more sacred and can fuel its larger body by absorbing the abundant oxygen packed in cold water. It has also been found to be useful in obtaining.
Learn more about An adaptation here:-https://brainly.com/question/1213023
#SPJ9
what components from the patella do not articulate with the femur in extension question 23 options: inferior 25% inferior 15% medial and lateral borders superior borders
The patella (kneecap) is situated in the patellofemoral groove of the femur, at the front of the knee joint. The patellar ligament is linked to its inferior side, and the quadriceps tendon to its superior side.
It is the largest sesamoid bone in the body and is categorized as a sesamoid type bone because of its location within the quadriceps tendon. This article will examine the patella's anatomy, including its surface characteristics, physiological purposes, and clinical applicability. Although partial patellar resection and internal fixing methods have been described, fractures near the base of the patella typically don't need surgery 76-78 Only if the quadriceps apparatus is completely disrupted (i.e., the stifle cannot be extended), the fracture gap is greater than 5 mm on radiographs, an articular fragment is obviously misaligned, or the fragments can be felt under the skin should surgery be tried.
Learn more about to patella visit here:
https://brainly.com/question/28891315
#SPJ4
Which zone contains permeable materials that are totally filled with water? which is a boundary between the layer that contains water and the layer that contains a mixture of moisture and air?
The zone which contains permeable materials that are totally filled with water is the Saturated zone of groundwater.
Water found beneath the surface of the Earth in the pores of soil and rock, as well as in fractures in rock formations, is referred to as groundwater.
What are the Groundwater Saturated and Unsaturated Zones?
The soaked zone of groundwater alludes to the zone wherein pores and rock cracks are loaded up with water as it were. The water table is the name given to the uppermost portion of the saturated zone.
Air and water pores make up the unsaturated zone, which is located below the saturated zone. This zone also contains rocks and soils. It is difficult to find water that can be used by humans.
So, there is water in the saturated zone, and there is air, soil, rock, and water in the unsaturated zone.
Learn more about groundwater here:
brainly.com/question/13160768
#SPJ4
answer..... saturated zone and water table
reason why.... i put the wrong answer and this was the right one so trustrepair systems target a single kind of lesion in dna and repair only that damage, while repair systems use a single mechanism to repair multiple kinds of lesions in dna.
The sympathetic division of the ans is also called the thoracolumbar division as it arises from the thoracic and lumbar regions of the spinal cord.
What is the thoracolumbar division?The peripheral nervous system's autonomic nervous system controls physiological functions that are carried out automatically, such as digestion, blood pressure, respiration, and sexual desire.
The thoracolumbar division of the autonomic nervous system is the part of the body that is responsible for kicking off the "flight or fight" reaction when the body is under stress.
Therefore, The sympathetic division of the ans is also called the thoracolumbar division as it arises from the thoracic and lumbar regions of the spinal cord.
Learn more about thoracolumbar division on :
brainly.com/question/29507759
#SPJ1
Help with the top question and question 4. A B & C please and thank you. The gizmo is called Cell Types
E. coli bacteria typically dwell in the intestines of healthy humans and animals. E. coli is typically not harmful.
a) A typical gram-negative rod bacterium is Escherichia coli. Its measurements are those of a cylinder with a radius of roughly 0.5 micrometers and a length of 1.0–2.0 micrometers.
b) Using a bioinformatic method, we examined the E. coli proteins that target host cell subcellular compartments, such as the ER, Golgi complex, peroxisomes, nucleus, mitochondria, and cytoplasm, which are implicated in the growth and progression of colon cancer.
c) One kind of bacteria is E. Coli. Since they are prokaryotes, bacteria lack membrane-bound organelles. Since a nucleus is a membrane-bound organelle, it is not present in bacteria.
To know more about E.coli, visit-
https://brainly.com/question/27795628
#SPJ13
which of the following are sustainable farming techniques? select the two correct answers.(1 point) responses tilling soil frequently tilling soil frequently limiting agriculture to rural areas limiting agriculture to rural areas planting trees in between rows of crops planting trees in between rows of crops planting a single crop over a large area planting a single crop over a large area rotating crops each year rotating crops each year
The following which are sustainable farming techniques include the following below:
Planting trees in between rows of crops.Rotating crops each year.What is Farming?This is referred to as the practice which involves the cultivation of crops and rearing of livestock for different types of purposes.
Farming techniques involve different parameters such as the soil and the environment in which they are planted, For example tilling the soil frequently will increase the risk of erosion as the uppermost part of the soil are easily washed away by water, wind etc.
Sustainable farming practices include planting trees in between rows of crops as it shields the young plant from harsh conditions and ensures that its growth and development is at optimum.
Rotating crops each year rotating crops each year ensures that some plants supply certain types of nutrients which are used by subsequent ones.
Read more about Farming here https://brainly.com/question/14533586
#SPJ1
Unit 5 Lesson 4: Farming Land Use
Answer: I Just Took The Quick Check For: Farming Land Use Quick Check.
All The Answers are,
Which of the following are sustainable farming techniques? Select the two correct answers.
A. planting trees in between rows of crops
E. rotating crops each year
In which situation would hydroponics be most useful for sustainable farming?
C. a desert area with limited rainfall
Which issue does terrace farming help solve?
A. heavy rains washing away soil from mountainous farms
By The Way all the answer's switch around so since I said a and E
E might be B, or A might be C. so don't look at the letters just look at the words.
Anyways all these answers are correct 100% 3/3
4. you amplified a segment of your own mitochondrial dna. do you expect the sequences of your pcr product vary from those of your classmates? why or why not? (2 points)
The number of DNA molecules in the reaction doubles after each round of PCR. The sequences of the PCR product will be the same for everyone because the same region is being amplified, despite the fact that mitochondrial DNA is inherited from the mother and hence varies from student to student.
What influences the PCR product's size?
The PCR primers' structure determines the size of the PCR result. To amplify a region of interest from a double-stranded DNA template, the user designs PCR primers. The two primers, which are always present, are made to border the area of interest.
Each student has a unique mitochondrial DNA profile because it is inherited from the mother.
Therefore, As a result of amplifying the same region, everyone's PCR product will have the same sequence.
Learn more about Mitochondrial DNA from the given link.
https://brainly.com/question/29318104
#SPJ4
What determines gene expression?.
The majority of control over gene expression occurs at the transcriptional level, mostly as a function of proteins binding to particular DNA information locations.Environmental and genetic variables affect gene expression. The genomic architecture of gene expression has considerably advanced over the years.
the method through which a gene product uses information from the gene." Gene expression enables genes to work in the body by transferring information from one gene to another, ensuring that each gene performs as intended.
learn more about gene expression here:
https://brainly.com/question/10343483
#SPJ4
In the last step of shotgun sequencing, a computer analyzes a large number of fragment sequences to determine the dna sequence of a whole chromosome. Given the following fragment sequences, what is the overall dna sequence?.
Using the theories of chromosome, we got that GATGACATGGCGTCAGTCGATGCG is the DNA sequence of a whole chromosome in the last step of shotgun sequencing.
Shotgun sequencing is the laboratory technique for determining the DNA sequence of an organism’s genome. The method actually involves randomly breaking up the genome into the small DNA fragments that are sequenced individually. A computer program looks for the overlaps in the DNA sequences, using them to reassemble the fragments in the correct order to reconstitute the genome
Hence, during the last step of shotgun sequencing, a computer analyzes a large number of fragment sequences to determine the DNA sequence of a whole chromosome, the DNA sequence is GATGACATGGCGTCAGTCGATGCG.
To know more about chromosome, visit here:
https://brainly.com/question/1596925
#SPJ4
Researchers have discovered that the value of r in aphids depends on the average temperature where the population lives, suggesting that climate change could affect population growth in aphids. Interpret the model.
The r model of growth in aphids depends on the average temperature where the population lives, thereby effectively climate change can affect population growth and an increase in average temperature may lead to overpopulation or extinction of the insect population.
What is the r model of growth?The r model of growth (also called latent growth) is used to indicate exponential growth when certain climate features are reached, ie, in absence of environmental constraints. This type of exponential growth (r model of growth) is characteristic of some groups of insects.
The presence of external new factors such as a sudden raise in the average temperature may drastically affect the number of individuals in species under an r model of growth.
Therefore, with this data, we can see that the r model of growth is affected by climate variables and therefore climate change may alter the number of individuals in the target population.
Learn more about the r model of growth here:
https://brainly.com/question/13427229
#SPJ1
An image has a length of 3mm. It has been magnified by x50. Calculate the actual length
Answer:
0.06mm
Explanation:
3÷50=0.06
0.06mm
The phenotypic ratio of the f2 generation of the dihybrid cross in mendel’s experiment with pea plant was.
In Mendel's experiment with the pea plant, the phenotypic ratio of the f2 generation of the dihybrid cross was 9:3:3:1.
What might plants of the F2 generation look like phenotypically?Four phenotypes can be seen in the F2 generation, which results from the cross of two such plants. In the ratios of 9:3:3:1: round and green, round and yellow, wrinkled and green, and wrinkled and yellow.
What is a Mendel of the F2 generation?By definition, a cross between two F1 people produces the F2 generation (from F1 generation). A 3:1 ratio was observed as a result of Gregor Mendel's tests across three generations (i.e. for every three purple-flower-bearing plants there would be one white-flower-bearing plant)
To know more about Mendel's visit:-
https://brainly.com/question/3186121
#SPJ4
How is the coordinated transcription of all the genes involved in a particular metabolic pathway brought about in eukaryotes?.
The enhancers of all the genes contain the same set of control elements.
What is genes?The term "gene" has a variety of meanings in biology. The single - molecule gene is a sequence of DNA nucleotides that's also transcribed to generate a functional RNA, whereas the Mendelian gene is the fundamental unit of heredity. Protein-coding genes as well as noncoding genes are the two categories of molecular genes. DNA will be first copied into RNA during gene expression. The RNA may perform a specific function directly or may serve as an intermediate template for just a protein. The basis for the inherited wealth of phenotypic traits is the transfer of genes to an organism's progeny.
To learn more about genes from the given link :
https://brainly.com/question/8832859
#SPJ4
a few normal adult cells retain the ability to divide indefinitly, replacing cell lineages that die out, these immortal cells are called
A few normal adult cells retain the ability to divide indefinitely, replacing cell lineages that die out. – These immortal cells are called stem cells.
What is the term for cells that continue to divide?In cell biology, the process of mitosis (/matoss/), during which replicated chromosomes are split into two new nuclei, is a stage of the cell cycle. The number of chromosomes is maintained in the genetically identical cells produced by cell division.
How do immortal cells work?
Immortalized cell lines are cells that have been made to reproduce endlessly so they can be grown in cultures for a long time. Immortalized cell lines come from a range of origins, such as cancers, that have chromosomal defects or mutations that allow them to divide indefinitely.
To know more about immortal cells visit:-
https://brainly.com/question/274381
#SPJ4