In which type of interaction are you most likely to use the transitional phrase so that?
A. problem and solution

B. compare and contrast


C. systems thinking


D. cause and effect

Answers

Answer 1

Answer:

c

Explanation:

Answer 2

The transitional phrase "so that" is most likely to be used in a cause and effect interaction.  Option D

What is transitional phrase?

The cause and effect interaction is the most common context in which the transitional phrase "so that" is used. This expression is frequently used to describe the intent or outcome of an event, action, or circumstance, which is a crucial component in cause-and-effect interactions.

It is beneficial to establish a link between the cause (the action, event, or circumstance) and the intended or expected impact or conclusion.

Learn more about transitional phrase:https://brainly.com/question/2372495

#SPJ3


Related Questions

Your friend has not been attending classes regularly write a letter to his orher parents informing them of his or her behavior and the likely consequence

Answers

Respected sir/madam,

this is to inform you that your son Zayn has not been attending school classes regularly. I have consistently seen him leave the classroom before the lecture starts with some of his other friends and roam around corridors without any purpose.

As you know the final exams are just around the corner and this is certainly not the time for him to waste time that is left. Thus, as a loyal friend I request you to guide him towards the right path and maintain a close watch, so he does not wander around.

Yours faithfully,

zen

To know more about waste time refer to the link below

https://brainly.com/question/2651365

#SPJ4

put the letters in order to make a word that completes the sentence

my brother is a ____ (rieldos) he joined the army last year.

she was wearing a beautiful gold ______(inach) around her neck .​

Answers

Answer:

soldier and chain is the answer

Are there ideas that relate to our current lives from the book Imported Americans by Broughton Brandenburg?

Answers

"The book 'Imported Americans'  written by Broughton Brandenburg is an account of the experiences of a disguised American and his wife."

" It is narrated by the author, about his brave wife, who endured with tough conditions that were extreme in nature for a woman of elegance and softness. Even in current scenario of 20th century, immigrants are usually categorized and discriminated, as addressed in the book. Many immigrants faced verbal and physical abuse owing to the fact that they were “different or weird.” While bulk immigration created many social issues, it also made new activity in the countries and states in which the immigrants were housed. Immigrants became easy victim of abuse, violence and exploitation."

To learn more about Immigrants,

https://brainly.com/question/13688875

#SPJ1

give me a good gym Spotify playlist

Answers

Answer:

Wrong place. But, just search it up.

Explanation:

Add my Spotify account JettaBeal and you will have a playlist

How does the story explain treys reason for running in the dark

Answers

Answer:

'In the Dark' Season 2 Episode 2: Fans heartbroken after Max has to leave but is thankful that Murphy has Jess. This week's episode of 'In the Dark' saw the return of a much-awaited character.

what the experiment could you do to find if the color related fo mood ?​

Answers

The "mood-altering impact" of color, according to study, is typically just temporary. Although walking into a blue environment could first make you feel calm, the feeling rapidly passes. Furthermore, research have shown that color has an impact on how well you perform.

What connection is there between color and mood?

Colors and emotions are inextricably linked. Warm colors may evoke distinct emotions from chilly ones, while bright colors can evoke different emotions from subdued ones. Everything depends on the use of color psychology.

We may experience a range of emotions through colors, including joy, sorrow, relaxation, and hunger. the causes of these reactions, including their psychological effects, biological conditioning, and cultural imprinting.

Therefore, it's essential to understand both the meanings and the tenets of color theory.

To learn more about mood checkout the link below :

https://brainly.com/question/760210

#SPJ9

What is the conflict on this side of the wild?

Answers

Answer:

In the novel The Call of the Wild, Buck, the main character has an internal conflict. Buck struggles between the natures of how he was raised, which was civilization and an instinctive savagery from his ancestors.

Explanation:

The possibility of evil due tomorrow please help I’m so confused!!!

Answers

Answer: "The Possibility of Evil" is a 1965 short story by Shirley Jackson. Published on December 18, 1965, in the Saturday Evening Post, a few months after her death, it won the 1966 Edgar Allan Poe Award for best mystery short story.

Why is a piece of music considered a form of persuasive argument

Answers

Answer:

Because it offers the artist a chance to convey a point of view to an audience through sound.

Explanation:

I hope this will be helpful for you

What are some similarities between The Tale of the Three brothers and The Pardoner’s Tale

Answers

"The Tale of Three Brothers" & "The Pardoner's Tale" are very similar.  Both of these stories have relatable themes and nearly identical plots. Three brothers are on an adventure in when they come across a treacherous river that they must cross. They use magic to create a bridge so they can cross safely by defying death.

What is an adventure?

An adventure is an exhilarating experience or undertaking that is typically bold, quite often risky. Traveling, exploring, skydiving, mountain climbing, scuba diving, river rafting, or other extreme sports are examples of activities that can be considered adventures.

Adventures are frequently undertaken to stimulate the mind or to accomplish a more important objective, such as the pursuit of knowledge that can only be attained through such activities.

Learn more about Adventures

https://brainly.com/question/25950911

#SPJ9

letter to a son ,the poem reminds us about the importance of family ties.do you think the poem is commentary on African family values​

Answers

Notable African values include large family practice, hard work, respect for senior members of the society, extended family system, religion, value for private property, language, and many others. The African family is the nucleus of existence, which places a premium on children.

Family is very important throughout Africa. Families, not individuals, are the building blocks of African society. Most people live in households that include not only the nuclear family (mother, father, children) but also members of their extended family (grandparents, aunts, uncles, cousins, and others).

In African society, there are a set of values that guide the behavior of every member. Specific mention could be made of values such as hospitality, chastity before marriage, truth, respect for old age, covenant-keeping, hard work, and good character.

Learn more about  African society here

https://brainly.com/question/1057561

#SPJ9

When is it appropriate to challenge authority? In what ways did Einstein challenge authority...explain!

Answers

I can say that it is appropriate to challenge authority when they are doing something that is wrong, unethical and can jeopardize the lives of people.

Is it ever acceptable to challenge authority in any situations?

If a person knows as well as understanding that one does not need to question authority, they will not do so but a person is one that is supposed to do what it right at all time.

I know  that it is not good to challenge authority but there are some instances that would warrant one doing so. It is done mostly in life or death situations.

Therefore, I can say that it is appropriate to challenge authority when they are doing something that is wrong, unethical and can jeopardize the lives of people.

Learn more about political authority  from

https://brainly.com/question/9173659
#SPJ1

At the end of the story, Shirley Jackson supplies a surprise ending. However, if we look at the beginning, we see there are hints and clues to the fact that Laurie could be Charles. What is this type of literary element called?

Answers

Answer:

a surprise ending

Explanation:

however if we look at the beginning

Can someone find me simile, metaphor, personification, symbolism, & irony (all r figurative language) & explain what it means in the story “The Lottery” by Shirley Jackson. Pls who answer will give brainlieat

Answers

Answer:

What is an example of personification in The Lottery?

Graves had selected the five slips and put them in the box. and he dropped all the papers but those onto the ground where the breeze caught them and lifted them off. " Effect: Personification amplifies the readers ability to relate in the situation and allows the reader to visualize what is going on.

What is the symbolism in The Lottery?

The lottery represents any action, behavior, or idea that is passed down from one generation to the next that's accepted and followed unquestioningly, no matter how illogical, bizarre, or cruel. The lottery has been taking place in the village for as long as anyone can remember.

What is the situational irony in The Lottery?

A situational Irony is when Tessie/ Mrs. Hutchinson Tessie gets picked for the person who gets stoned/killed. She didn't know that she was going to be picked for who to kill.

What type of irony is in the lottery?

In The Lottery, Shirley Jackson uses situational irony, as well as symbolism to convey a symbolic message to the reader. A major literary element found throughout The Lottery is the use of situational irony.

What is a metaphor in The Lottery?

Metaphor: black box= death and tradition, stones=accessible weapons, old tradition. Personification: "[the breeze] caught them and lifted [the slips of paper] off"

Explanation:

Martha graham modern dance innovator answer key

Answers

Martha Graham is an enormous figure in the dance industry. She was a true innovator who broke free from the limitations of traditional ballet to pave the way for the bold new world of modern dance.

What is the central idea of Modern Dance Innovator by Eva Milner ?

Through her career as a dancer, choreographer, and teacher, Martha has inspired audiences and many dance students. Her organization, the Martha Graham Dance Company, has produced some of the greatest dancers working today.

Martha Graham was born in 1894 in a little Pennsylvanian village not far from Pittsburgh. Her father was a doctor who specialized in treating neurological disorders. The way a patient's body moved and how it may reveal illnesses and issues piqued his interest. This confidence in the body's ability to convey what is inside was shared by Martha. She would communicate her beliefs via dance rather than medication.

To learn more about Modern Dance checkout the link below :

https://brainly.com/question/1384028

#SPJ9

Helpppppp!!!!
A short story tells the tale of two brothers fighting on opposite sides of the American Civil War. Which of the following elements of setting would be most present in the story?
O Historical context
O Mood
O Place
O Time

Answers

Answer:

other answer is correct

Explanation:

Is the first one,Historical context

What are some steps in deconstructing a play?
read it, draw conclusions, look for themes, interpret
make predictions, read it, interpret, make connections
make predictions, read it, analyze, find the message
read it, find the message, analyze, make connections

Answers

Some steps in deconstructing a play are:

4. read it, find the message, analyze, make connections

What is a Play?

This refers to the drama that is enacted on an elevated platform that has an audience to watch and dramatis personae

Hence, we can see that Some steps in deconstructing a play are:

4. read it, find the message, analyze, make connections

This would help you to understand the message of the play and to also follow the action as you have read it, understood the message, made your analysis and then connections.

Read more about plays here:

https://brainly.com/question/19599489

#SPJ1

Answer:

The correct answer is make predictions, read it, interpret, make connections.Hope this helped you!

Explanation:

1.

Look for the assumptions. An article entitled 'how to deconstruct a text' likely assumes a text can be deconstructed, and also that that deconstruction can interpreted.

2.

Look for the tension between the spirit and the letter of the text.

3.

Consider the dynamic and static elements of meaning

Dont forget to hit that Brainliest button!

1911

THE MATCH

There never was a time when the world was without fire, but there was a time when men did not know how to kindle fire; and after they learned how to kindle one, it was a long, long time before they learned how to kindle one easily. In these days we can kindle a fire without any trouble, because we can easily get a match; but we must remember that the match is one of the most wonderful things in the world, and that it took men thousands of years to learn how to make one. Let us learn the history of this familiar little object, the match.

Fire was first given to man by nature itself. When a forest is set on fire by cinders from a neighboring volcano, or when a tree is set ablaze by a thunderbolt, we may say that nature strikes a match. In the early history of the world, nature had to kindle all the fires, for man by his own effort was unable to produce a spark. The first method, then, of getting fire for use was to light sticks of wood at a flame kindled by nature—by a volcano, perhaps, or by a stroke of lightning. These firebrands were carried to the home and used in kindling the fires there. The fire secured in this way was carefully guarded and was kept burning as long as possible. But the flame, however faithfully watched, would sometimes be extinguished. A sudden gust of wind or a sudden shower would put it out. Then a new firebrand would have to be secured, and this often meant a long journey and a deal of trouble.

In 1827, John Walker, a druggist in a small English town, tipped a splint with sulphur, chlorate of potash, and sulphid of antimony, and rubbed it on sandpaper, and it burst into flame. The druggist had discovered the first friction-chemical match, the kind we use to-day. It is called friction-chemical because it is made by mixing certain chemicals together and rubbing them. Although Walker's match did not require the bottle of acid, nevertheless it was not a good one. It could be lighted only by hard rubbing, and it sputtered and threw fire in all directions. In a few years, however, phosphorus was substituted on the tip for antimony, and the change worked wonders. The match could now be lighted with very little rubbing, and it was no longer necessary to have sandpaper upon which to rub it. It would ignite when rubbed on any dry surface, and there was no longer any sputtering. This was the phosphorus match, the match with which we are so familiar.

What was the main problem with relying on nature to start a flame? (5 points)

a
Fire could only be collected with "sticks of wood" that were hard to find.
b
Fire had to be "carefully guarded," requiring someone to stay behind from hunting.
c
Fire had to be "carried to the home," which could be dangerous and awkward.
d
Fire was likely hard to find, requiring a "long journey and a deal of trouble."

Answers

Answer:

D. Fire was likely hard to find, requiring a "long journey and a deal of trouble."

Maria wrote the following topic sentence for an essay about checkers: The rules of checkers have changed over the centuries; In the 1500s, the first actual rulebook was published. What is the error in Maria's sentence? She should have multiple semicolons because she is listed serial items. The first part of the sentence is not an independent clause. The semicolon is misplaced and should appear after 1500s. The word after the semicolon does not need to be capitalized because it is not a proper noun.

Answers

The error in Maria's sentence from the topic sentence given about checkers is The word after the semicolon does not need to be capitalized because it is not a proper noun.

What is a Sentence?

This refers to the use of words to communicate that contains a subject and predicate.

Hence, we can see that The error in Maria's sentence from the topic sentence given about checkers is The word after the semicolon does not need to be capitalized because it is not a proper noun.

The given word "in" is not a proper noun and it is not the start of a sentence, therefore it should not be capitalised.

Read more about topic sentences here:

https://brainly.com/question/5526170

#SPJ1

Answer: It's D!

Explanation: It's right 100% i got it right on the quiz

Brainliest? I've never got one before.

solve pls brainliest

Answers

Cause: In 1747, sailors faced a painful disease called scurvy.
Effect: As a result of scurvy, they suffered horribly.

Cause: Dr. James Lind wanted to find the best treatment for scurvy.
Effect; So, he conducted an experiment with six treatments.

Cause: Some sailors ate two oranges and a lemon.
Effect: Therefore, they got better.

Cause: Albert Szent-Györgyi later discovered vitamin C and how it prevents scurvy.
Effect: none of the given

The word camouflage is an antonym of the word uncover. Which option tells the meaning of the word camouflage?

Answers

Answer:

I cant see the answer choices but camouflage means hidden or disguised.

Explanation:

Estefani is writing a paper about the history of jazz music. which sentence best introduces a precise claim for this topic? the music we know today as jazz started over 100 years ago in new orleans, louisiana. while jazz has changed a lot since then, the main idea is the same. the musician must know how to improvise. it takes a lot of practice to be able to do this. when jazz first started it was a blend of blues, ragtime, and marching band music. musicians, many of whom did not read music very well, played familiar songs for people to enjoy. people listened to music as a daily part of their lives. songs were played at town events, family picnics and even at funerals. as these songs were played, the musicians would improvise by adding extra notes or changing the rhythm. these impromptu changes allowed the music to evolve as more musicians performed it.

Answers

The phrase "Jazz music has a rich and fascinating history that helps form the way it is now" conveys a specific assertion about the subject in the most effective way.

Jazz is a type of music that deals with intricate rhythms, harmonies, and a lot of improvisation.

Jazz music has seen many changes throughout the years due to the fact that it began approximately 100 years ago, yet its core concept has stayed constant. People have long appreciated jazz music, which was improvised by fusing it with blues and marching bands. Its lengthy and diverse past has shaped it into what it is today.

To Learn more about Jazz music, click the links

brainly.com/question/2736475

#SPJ1

ohan is listening to his principal deliver a speech about the importance of physical education in school. Johan is planning to write an argumentative essay on the topic. After the speech, Johan should first
begin to formulate his thesis.
review and clarify his notes.
file his notes and read them later.
decide what kind of shorthand to use.

Answers

To write an argumentative essay, Johan should first review and clarify his notes.

What is an essay?

The essay is a written document intended to communicate an idea, make an argument, exhibit emotion, or start a debate. An essay is a nonfictional instrument used to communicate a writer's thoughts.

An argumentative essay entails researching a topic, gathering facts, and locating proof to effectively support the writer's thesis. As a result, after hearing the principal's speech, Johan should review and re-examine his notes to make his message less complex and more accessible.

To know more about essays, click on the link

https://brainly.com/question/11606608

#SPJ9

Answer:

(B) review and clarify his notes.

Explanation:

the other person is also correct

Fantastic event in "house taken over" story

Answers

The Fantastic event in "house Taken Over" is that an unknown and apparently supernatural force is slowly taking up portions of the house wherein the narrator and his sister live. eventually, the unknown takes over all dwelling quarters, and the narrator and his sister are compelled out into the street.

Magical Realism is a literary or creative style wherein realistic narrative and an acceptance of magic in the real international. Julio Cortazar's “houseTaken Over” is a good instance of magical realism, because the house is taken over via something this is uncommon and supernatural.

"House Taken Over" suggests that fear may be portrayed in very subtle, implicit approaches. Irene and her brother act nonchalant about the invaders taking over their home while they are conscious, however specific excessive emotion of their sleep, displaying how they virtually experience.

The upward thrust of the Peronism that Levinson wrote approximately and cited previously brought about the ultimate introduction of the “house Taken Over” due to Cortazar's unhappiness with the government. Cortazar writes in the tale about how the residence the brother and sister owned become inherited from their family.

Learn more about  "house taken over" here:- https://brainly.com/question/25512516

#SPJ1

Is it possible to be patriotic and a global citizen at the same time? yes, or no? justify your answer

Answers

YES, it is possible to be patriotic and a global citizen at the same time.

The Patriotism Dilemma: Is it Possible to be patriotic and a global citizen at the same time?

In today’s world, it seems like more and more people think that you can’t be patriotic and love your country while also participating in global activities, learning about people from other countries, or even going outside your country.

But why should we limit ourselves like that? If we don’t want to participate in global activities, that’s one thing – but why would anyone want to limit themselves? Being patriotic doesn’t mean you have to be anti-globalist, and being a global citizen doesn’t mean you have to not love your own country.

Patriotism can be defined as love of one’s country, or the act of fighting for your country or serving your country in a military capacity.

The term seems to be commonly used to refer to someone who loves their own country above all others and has the tendency to hate other countries or discriminate against them because they are different from the person’s place of origin or homeland.

However, just as there are patriotic people in this world, there are also global citizens who love and care about the welfare of not only their own country but also the welfare of other countries and the entire world as well.

I - Why Patriotism Matters?

Most would assume that patriotism and the concept of being a global citizen are mutually exclusive. One cannot be both but there are many scenarios where one can.

For example, let's say your best friend had just received an invitation to compete in the Olympics representing their home country.

There would be some bias, I would argue it even more so on behalf of that person as they carry our national flag across an international field, representing not only their home country but their whole world.

II - How to Practice Patriotism in our Daily Lives?

With our country so divided, it's important to look for ways to promote patriotism in our daily lives. Below are five ideas for how we can express gratitude for our country in small ways every day.

We can write thank-you notes or cards to those who help us, such as teachers, police officers, doctors, or firefighters.

We can volunteer our time at a local soup kitchen or homeless shelter or spend time with family members and friends.

We can also honor the military by volunteering to participate in an annual event like the Veterans Day Parade or Memorial Day Ceremony.

Finally, we can take time out of our busy days to reflect on the blessings that living in the Country has given us by writing down three things that make us proud of this country (i.e., freedom of speech, strong economy).

A Call To Action:

Being a patriot is about loving your country for its flaws as well as for its triumphs. It means working hard to improve it, and recognizing that it will never be perfect.

A global citizen cares deeply about the world we live in but doesn't look outside her own country for solutions.

By caring more about what's good here at home than in other countries, patriotism creates responsibility and hope.

To learn more about Patriotism refer to:

https://brainly.com/question/6599053

#SPJ4  

Read these sentences from "The Story of Baba Abdalla."

I had not gone far before the demon of ingratitude and envy took possession of my heart. I mourned the loss of my camels, but even more the riches with which they were loaded. "The dervish," said I to myself, "has no need for all this wealth, since he is master of the treasure and may have as much as he pleases."

Why is it so easy for Baba Abdalla to change his mind about keeping his promise?
A He is greedy and wants more for himself.
B The dervish already has more wealth than he has.
C He doesn't think the promise is fair.
D He misses his camels.

Answers

Answer:

Its

Explanation:Inthe paragraph it say's I mourned the loss of my camels

It is so easy for Baba Abdalla to change his mind about keeping his promise because:

A. He is greedy and wants more for himself.

Why was it very easy for Baba Abdalla to change his mind?

It was very easy for Baba Andalla to change his mind because he was a greedy person who wanted more than he already had. After all the warnings from the Dervish, he rejected sound counsel to seek more treasures, and in the end, he paid for this with his right eye.

The lesson from the story is for us to be content with what we already have. Baba Abdalla was not content with his camels and the benefits he gained from them.

Learn more about Baba Abdalla here:

https://brainly.com/question/17547655

#SPJ1

how does poe say he creates contrast in the portrayal of the bird in "the raven"

Answers

Poe says he creates contrast in  the portrayal of the bird in "The Raven" because the bird's entrance is almost comical, and then it becomes ominous.

The portrayal of the raven

In the poem "The Raven," by Edgar Allan Poe, the speaker is haunted by a raven. The bird flies into the speaker's room and says one word, repeatedly - "nevermore". The raven is there remind the speaker that he will never see the woman he loves again now that she is dead.

Poe himself, in "The Philosophy of Composition," explains how he creates contrast in the portrayal of the bird. The way the bird comes into the room is almost comical, as it flies in while frantically fluttering its wings. Soon, however, it becomes ominous, as it answers the speaker's questions only to haunt him.

With the information above in mind, we can conclude that the answer provided is correct.

The complete question with the missing answer choices is the following:

In Edgar Allan Poe's "The Philosophy of Composition," how does Poe say he creates contrast in the portrayal of the bird in "The Raven"?

The bird begins with kind news, and then it delves into sad news.The bird's entrance is almost comical, and then it becomes ominous.The bird talks a lot at first, and then it refuses to answer questions.The bird's appearance is startling at first, and then it becomes commonplace.

Learn more about "The Raven" here:

https://brainly.com/question/6319512

#SPJ1

Select the sentence that is written correctly.
Unfortunately, the paper with the solution to the puzzle has vanished, we can't find it anywhere.
Many scientists, however, do not agree with this theory.
Confetti was scattered all over the patio tracked into the house, and strewn all the way to the front door.
This exclusive offer is brought to you by Mayville Camping Emporium, Inc, your connection to the sporting
world.

Answers

The sentence that is written correctly is Many scientists, however, do not agree with this theory.

A sentence is the primary unit of language which expresses a whole notion. A sentence is a grammatically whole idea. All sentences have a noun or pronoun factor known as the situation, and a verb element called the predicate.

An easy sentence is a sentence that consists of a single unbiased clause. In grammar, a clause is a set of phrases that includes a topic and a predicate. The subject is the phrase that indicates what a sentence is set or who or what's performing a movement.

Learn more about sentences here:-https://brainly.com/question/552895

#SPJ9

i need help as fast as possible

Answers

The explanation of how the Latin prefix "com" contributes to the meaning of words like "compression", and "compare", is given below:

Based on the context of the sentences, one can immediately see that the first sentence talks about an uncooked egg that is under compression and this shows that the Latin prefix "com" means “with,” “together,” “in association,” and the word compression shows the egg is being pressed together

What is a Root Word?

This refers to the base word that is used in order to create new words that has a base meaning through the addition of suffixes and prefixes.

Hence, we can see that The explanation of how the Latin prefix "com" contributes to the meaning of words like "compression", and "compare", is given below:

Based on the context of the sentences, one can immediately see that the first sentence talks about an uncooked egg that is under compression and this shows that the Latin prefix "com" means “with,” “together,” “in association,” and the word compression shows the egg is being pressed together

Read more about root words here:

https://brainly.com/question/10240140

#SPJ1

How unequal access to basic services contributes to poverty?​

Answers

Answer:

It can act in many ways: Difficulties in accessing health services increase the risk of suffering physical and mental health problems, which makes it difficult to access work under equal conditions.

The difficulties of access to training and culture hinder personal and work development.

The difficulties of access to basic services create a situation of marginality that leads to a spiral, due to the fear that culturally develops towards poverty, which makes people hate (aporophobia) and flee from the poor, because the poorer will have less support social and greater difficulty of integration.

Explanation:

Other Questions
Which functional group, if found in the r group of an amino acid, would most likely be able to form an ionic bond force with a charged amino group on another molecule?. Determine whether the events are mutually exclusive or not mutually exclusive. Then find the probability. Round to the nearest tenth of a percent, if necessary.drawing an ace or a heart from a standard deck of 52 cards For a second order reaction, the initial reactant concentration, [a]o, is 0.93 m. after 16.7 s, the concentration is 0.65 m. what is [a] after 84 s? Place these words in the correct order based onthe most gravity to the least gravity.UniverseMoonPlanetGalaxyStar Juan's professor lectures on the fact that certain features in animals have been passed down from one generation to another. what theory is juan's professor probably describing? If you have three junit test methods written in the same testing class and the first one fails its assertions, will he other methods still be executed? A bakery is making whole-wheat bread and apple bran muffins. for each batch of break they make $35 profit. for each batch of muffins, they make $10 profit. the break takes 4 hours to prepare and 1 hour to back. the muffins take 0.5 hours to prepare and 0.5 hours to bake. the maximum preparation time available is 16 hours. the maximum bake time available is 10 hours. let x = Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA In civil rights literature, which ideology was often at odds with multiculturalism? A. Disillusionment B. Symbolism C. Disenfranchisement D. Black Power Based on what you know of the peptide bonds that link together amino acid residues, why would proline's side chain reduce the flexibility of the backbone? What are "affiliates" asKing uses the word?Consider the context of how the word is used multiple times in paragraph 2. The frequency of a microwave signal is 9.76 ghz. what is its wavelength in meters? help me asap im in a dba back to basics exam and didnt study Imagine that an employer purchases a health insurance plan that costs $365 per month, but requires that the employee pay $35 per month toward the cost of the plan. If the employee's salary is What is the slope of the line that passes through the points (6,2) and (-18,2) If you had to choose one scene from Equianos story to turn into a visual illustration in order to capture his narrative, which one would it be and why? A 78-year-old man is admitted to the emergency department (ed) with bradycardia resulting from overdose of donepezil. the nurse knows that the ed is likely to order which medication? If you see a 1st quarter moon today, what will people on the other side of the earth see later today? What elected group's laws and regulations make laboratory safety a legal requirement in the united states of america? After administering medication to a client subcutaneously, the nurse removes the needle at the same angle at which it was inserted. which explains the nurse's action?