Q1. The diagram below represents different models of the atom. to A B C D E (a) Which diagram shows the plum pudding model of the atom? Tick one box. A B C D​

Answers

Answer 1

Diagram B represents the plum pudding model of the atom.

Plum pudding model was proposed by Thomson. He knew that atoms are of neutral charge. Therefore, he reasoned that there must be a source of charge within the atom to counterbalance the charge on the electrons. This led Thomson to propose that atoms may well be described as negative particles floating within a soup of diffuse charge.

This model is usually called the pudding model of the atom, because of the actual fact that its description is incredibly just like Christmas pudding, a well-liked English dessert.

However, Thomson’s atomic model did not explain how the electric charge holds on the electrons inside the atom. It also did not explain an atom’s stability.

The theory failed to mention anything about the nucleus of an atom.

It was unable to elucidate the scattering experiment of Rutherford.

Even though Thomson’s atomic model was inaccurate and had some drawbacks, it provided the bottom for several other atomic structure models afterward. it's one in all the muse models that led to significant and revolutionary inventions later.

Therefore, option B is the diagrammatic representation of plum pudding model.

To learn more about the application of atomic models in modern science click below,

https://brainly.com/question/2193084

#SPJ9


Related Questions

Tom adds solid sodium hydroxide to a flask of water at room temperature. After he stirs the water, some of the
sodium hydroxide dissolves, however, a small amount of sodium hydroxide still remains at the bottom of the flask.
He heats the flask of sodium hydroxide and water for 10 minutes, and the sodium hydroxide on the bottom of the
flask disappears. How does heating the water cause the remaining sodium hydroxide to disappear?

Answers

Answer: It has a lower boiling/melting point than the water


Which of the following pieces of lab equipment would be used to measure volume?
Hot plate
Electronic balance
Test tube
Graduated cylinder

Answers

Graduated Cylinder is correct
Graduated cylinder is the answer

Consider the process of diluting 1.2 m nh4cl solution to prepare 1.4 l of a 0.25 m nh4cl solution. determine if each of the follow statement is true or false.

Answers

The process of diluting 1.2 m nh4cl solution to prepare 1.4 l of a 0.25 m nh4cl solution. To determine if each of the follow statement is true or false.

The assertion is true.

What is dilution?

By incorporating more solvent, dilution refers to the process of lowering a solute's concentration in a solution. We increase the solvent without increasing the solute in a solution to dilute it. After that, we vigorously mix the resulting solution to make sure that it is evenly distributed throughout.

The assertion is true.

(1) The equation for dilution

A balance of moles of the solute, in this case NH4Cl, is expressed as M1V1 = M2V2.

Calculating dilution involves using the M1V1 = M2V2 equation.The volume of the concentrated solution is denoted by M1, and M1 represents its molarity. The molarity is M2, and the volume of the diluted solution is V2.The conservation of moles principle serves as the foundation for this equation.

To learn more about dilution from the given link below,

https://brainly.com/question/25292980

#SPJ4

Question 6 (5 points)
Assume that Element Q has the following three isotopes: 248Q,
252Q, and 259Q. If the atomic mass of Q is 258.63, which of its
isotopes is most abundant?
Complete the following:
4
. Make a claim that answers the question
Support your answer with evidence from the information
given
• Explain your reasoning

Answers

The most abundant isotope here is 259Q.

What are isotopes?

We know that isotopes refers to those atoms of elements that have the same atomic number but different mass numbers. The reason for the difference in the mass number is because they do not have the same number of neutrons. Recall that the mass number is the sum of the number of protons and neutrons in the nucleus of an atom.

The existence of isotopy is the reason why the relative atomic masses of elements are not whole numbers.

Note that the isotopes are not abundant to the same extent. The isotopes that are are more abundant tend to affect the value of the relative atomic mass. The relative atomic mass is nearest in value to the mass of the most abundant individual isotope.

As such, the most abundant isotope here is 259Q.

Learn ore about isotopes:https://brainly.com/question/11680817

#SPJ1

&
What correctly describes the molecules in very dilute sugar solution at
room temperature?

Answers

Widely separated, moving at random describes the molecules in very dilute sugar solution at room temperature.

Sugar dissolve in room temperature water :

This is attributable to the fact that sugar is soluble in liquid water under all conditions of pressure and temperature. From about 180g of sugar in 100ml of water at 0 degrees to about 490g in 100ml of water at 100 degrees, the solubility of sugar does increase with temperature. As the saturated concentration rises, the solution will become unsaturated. Temperature increases the solubility.

Do sugar dissolve in cold liquid?

In general, sugar dissolves more readily at higher temperatures than it does at lower ones. Because the molecules in hot water (or coffee) move more quickly and are spaced farther apart, the sugar can mix with them more easily. In fact, sugar is very soluble; it just isn't at lower temperatures.

To know more about solubility :

https://brainly.com/question/28170449

#SPJ9

What is the iupac name for the following compound? 3,5-dimethylheptanedioic acid

Answers

The iupac name for the following compound is 3,5-dimethylheptanedioic acid

The worldwide organization that represents chemistry and allied disciplines and technology is called the International Union of Pure and Applied Chemistry (IUPAC).

The International Union of Pure and Applied Chemistry (IUPAC) is the foremost expert on chemical language and nomenclature, including the naming of new elements in the periodic table, standardized measurement techniques, atomic weights, and a wide range of other critically analyzed data.

A global standard for naming chemicals is to be established through the IUPAC system of nomenclature in order to improve communication. The system's objective is to assign each structure a distinct and clear name and to associate each name with a distinct and clear structure.

To learn more about IUPAC please visit
https://brainly.com/question/16631447
#SPJ4

What is the major organic product that results when hept-1-yne is treated with 2 equivlents of hbr

Answers

The major organic compound is 2,2-dibromoheptane.

Any of a vast group of chemical compounds known as organic compounds contain one or more carbon atoms that are covalently connected to atoms of other elements, most frequently hydrogen, oxygen, or nitrogen. Carbides, carbonates, and cyanides are among the few carbon-containing substances that aren't categorized as organic.

Organic compounds make up about one-third of all industrially manufactured substances. Organic compounds make up the majority of foods, medications, clothing fibers, and plastics, as well as all living things. Many different fields can benefit from the identification of organic molecules. Scientists have just created a new technique dubbed "material degradomics" to track the deterioration of antiquated books and historical artifacts. Paper develops the well-known "old book smell" when it ages due to the emission of organic chemicals in gaseous form.

To learn more about organic compounds please visit-
https://brainly.com/question/5994723
#SPJ4

Determine the number of protons, neutrons, and electrons present in each of the atoms. cr53 protons: neutrons: electrons: ru103 protons: neutrons: electrons:

Answers

Chromium(Cr)53 has 24 protons, 24 electrons and 29 neutrons. Ruthenium(Ru)103 has 44 protons, 44 electrons and 59 neutrons.

In any atom, the atomic number, usually denoted with the letter Z, is always equal to the number of protons. For instance, if an atom has the atomic number 10, it will also have 10 protons. In a neutral atom, the number of protons is equal to the number of electrons. To get the number of neutrons, we subtract the number of protons from the atomic mass. The atomic mass or mass number is the addition of the number of protons and neutrons.

Chromium(Cr) 53

In the question, we are only given the atomic mass - 53. To know the number of protons, we need to get the atomic number. On the periodic table, Chromium (Cr) is element number 24 (which is the atomic number) hence, it also has 24 protons. Since the atom is neutral, it will also have 24 electrons. To get the number of neutrons, we subtract 24 from 53, which will give us 29 neutrons.

Ruthenium(Ru) 103

Ruthenium (Ru) has the atomic number 44, showing that it has 44 protons. It is also a neutral element, so it will also have 44 electrons. The atomic mass we are given in the question is 103. Therefore, to get the number of neutrons, we subtract 44 from 103, which will give us 59 neutrons.

Learn more about the elements here:

https://brainly.com/question/10728894

#SPJ4

Identify a substance that is not in its standard state.
o3 h
o2
zn
xe

Answers

A substance that is not in its standard state is option(b) i.e, H.

The standard state of a substance occurring at the specified temperature and one atmosphere of pressure is the typical condition of a substance occurring in a condensed phase.

Eleven elements are gases in their standard state. Including all noble gases and the halogens fluorine and chlorine (He, Ne, Ar, Kr, Xe, Rn). Hydrogen (H), oxygen, and nitrogen make up the remaining three. All other elements are solid in their native state.

The concept of standard state conditions stipulates that liquids and gases must be pure, solutions must be at 1 M concentration, and 1 atm of pressure is used in STP calculations involving gases that resemble ideal gases. Although the temperature is not stated, most tables gather information at 25 degrees C. (298 K).

To know more about standard state refer to:  https://brainly.com/question/13074327

#SPJ4

Carbon is essential to the structure of every organic compound.
a. true
b. false

Answers

answer:

a. true

explanation:

carbon is found in all organic compounds; it's the main compound. it's essential to life and without it earth would be nonexistent.

What is the most abundant isotope of Iridium (Ir)?

Question 1 options:

Iridium-77


Iriduium-192


Iridium192.22

Answers

The most abundant isotope of iridium is Iriduium-192.

What is the most abundant isotope?

An element is composed of isotopes. The isotopes of an elements have different mass numbers but the same atomic number. These difference in the mass number is caused by differences in the number of neutrons.

Hence, we can see that all elements do have isotopes. The chemical and physical properties of isotopes may be the same save that the rate of reaction of the individual isotopes may slightly differ. The most abundant isotope has the highest length in the mass spectrum.

We can see that there are three isotopes of Iridium that are common. The most abundant isotope of iridium is Iriduium-192.

Learn more about iridium:https://brainly.com/question/20713777

#SPJ1

SI CONVERSIONS CHEMQUIZ (please help i tried on my own and got 4/10 teacher did not explain conversions well)

Answers

The following are the results of the unit conversions as shown in the question;

1) 43900 Pa

2)  71.3 Pa

3)  5.36 * 10^-3 L

4) 0.586 g

5) 9.37 * 10^-7 L

How do you carry out conversions?

We know that conversion from one unit to another is performed by the use of conversion factor. We know that we could carry out these conversions from one unit to another in order to improve the ease at which we are able to perform a calculation.

We know that dimensions are very important when we are trying to effect the conversion. Let us now try to effect each of the conversions as shown;

1) 4390000 * 1 Pa/100c Pa = 43900 Pa

2) 0.0713 kPa * 1000 Pa/1 KPa = 71.3 Pa

3) 53.6 dL * 1 L/10000 dL = 5.36 * 10^-3 L

4) 586 mg * 1 g/1 * 10^3 = 0.586 g

5) 0.937 μL * 1 L/1 * 10^6  μL = 9.37 * 10^-7 L

Learn more about conversion factor:https://brainly.com/question/28366871

#SPJ1

Apply the law of conservation of energy to explain how energy is conserved when water evaporates.

Answers

"Energy can be neither created nor destroyed but can only be converted from one form to another" In the above case liquid is converted to gas keeping the mass of the molecules the same.  The energy lost while evaporating is conserved.

Explain the law of conservation of energy.

The water evaporates into water vapor, where the total water molecules remain the same, the molecules are just spread out over a greater volume but the mass remains the same.

Evaporation occurs when a molecule gains or loses energy, and it exists in the form of heat. This is how the energy is conserved during evaporation.

To know more about the law of conservation of energy visit:

https://brainly.com/question/20971995

#SPJ9

Which kind of change is NOT an indicator of a chemical reaction?

Answers

Color. A substance's changing color does not always mean that something has changed chemically. For instance, altering a metal's color does not alter its physical characteristics.

What is not a chemical reaction?

A substance's shape is a physical attribute, and any modification of a physical property cannot be interpreted as a sign of a chemical modification.

In essence, a physical change does not result in the creation of a new material, whereas a chemical change does.

While undergoing a physical change, a material may change shape or form, but no chemical processes take place, and no new compounds are created.

Therefore, a change in color is not a sign of a chemical reaction.

Learn more about chemical reaction here:

https://brainly.com/question/3461108

#SPJ1

How can electrical conductivity be used to determine bond type? (In your CER make sure to also explain why different bonds behave differently) 1 claim 3 reasoning and 3 evidence

Answers

Electrical conductivity can be used to determine the bond type because there are valence electrons that are not able to conduct electricity while free electrons can conduct electricity.

What are valence electrons and free electrons?

The valence electrons can be defined as those having a negative charge that are linked to atomic particles, while the free electrons do not form atomic particles in the sense they are unbound to atomic particles.

In conclusion, electrical conductivity can be used to determine the bond type because there are valence electrons that are not able to conduct electricity and while free electrons can conduct electricity.

Learn more about valence electrons here:

https://brainly.com/question/371590

#SPJ1

Why is it uncommon for noble gases to form chemical bonds?

Answers

Noble gases are exceedingly stable and unlikely to form chemical connections since they have minimal inclination to receive or lose electrons, thanks to the complete valence electron shells of these atoms.

Any one of the seven chemical elements that compose Group 18 (VIIa) of the periodic table is referred to as a noble gas. Helium (He), neon (Ne), argon (Ar), krypton (Kr), xenon (Xe), radon (Rn), and oganesson are the constituent elements (Og). The noble gases are inflammable, tasteless, colorless, and odorless. The term "noble" has long been used in science and alchemy to describe how resistant metals like gold and platinum are to chemical reactions. As their atomic numbers rise, the abundances of the noble gases fall.

German chemist Friedrich E. Dorn discovered radon for the first time in 1900, and in 1904 it was recognized as a member of the noble-gas family. In 1904, the work of Rayleigh and Ramsay was recognized with Nobel Prizes.

To learn more about noble gases please visit-
https://brainly.com/question/11764545
#SPJ9

After an animal takes in nutrients to make needed materials what is the best explanation for what the cell will do next in order to maintain homeostasis

Answers

There are three primary ways that the animal cell membrane keeps things in balance: enabling the membrane to flow fluidly, controlling the process by which water moves from a high concentration to a low concentration, and maintaining particular ion concentrations.

Negative feedback loops keep homeostasis in check. Positive feedback loops may be necessary for life to exist even when they actually push the organism further away from homeostasis. The neural and endocrine systems of mammals regulate homeostasis.

For instance, an animal must use the thermoregulation mechanism to control body temperature. Cold-adapted organisms, like the polar bear, have physical characteristics that enable them to survive extreme cold and retain body heat. Fur, feathers, blubber, and fat have structures that help with this kind of insulation.

Learn more about homeostasis here:

https://brainly.com/question/3888340?referrer=searchResults

#SPJ4

Please help, this is due tomorrow and I don’t understand.

The accepted value for the
density of iron is 7.874
g/cm^3. Give two examples
of a measurement for density
that would be accurate?

Answers

it can change everything

A neutral atom has a mass number of 119 and has 69 neutrons. write its isotopic symbol.

Answers

The Isotopic symbol of the element that has a mass number of 119 and has 69 neutrons is ₅₀¹¹⁹Sn.

What is atomic number and mass number?

Atomic number is the number of protons present in the nucleus of the atom of an element.

The mass number is the sum of the protons and neutrons present in the nucleus of the atom of the element.

The mass number of the element = 119

The neutron number = 69

The atomic number = 119 - 69

Atomic number = 50

The element with atomic number 50 is Tin with symbol Sn.

The Isotopic symbol of the element is ₅₀¹¹⁹Sn.

Learn more about isotopic symbol at: https://brainly.com/question/160068

#SPJ1

A current of 3.95 a is passed through a ni(no3)2 solution. how long, in hours, would this current have to be applied to plate out 8.90 g of nickel?

Answers

1.64 hours will be taken to plate out 8.90g of nickel.

Nickel (Ni), is a chemical element and Group 10 ferromagnetic metal with high resistance to oxidation and corrosion. Although nickel is more important either as a pure metal or in the form of alloys for its various home and industrial applications, it is also known for being silvery white, robust, and tougher than iron.

Iron and the element nickel extremely seldom co-occur in terrestrial and meteoric deposits. Baron Axel Fredrik Cronstedt, a Swedish chemist and mineralogist, separated the metal in 1751 after preparing an impure sample from an ore containing niccolite. Earlier, a similar ore of this kind was given the nickname Kupfernickel in honor of "Old Nick" and his naughty gnomes because, while looking like copper ore, it produced a brittle, foreign metal.

To learn more about nickel please visit-
https://brainly.com/question/15027126
#SPJ4

Which statement best describes the difference between dissolution and melting? (1 point)
O Dissolution involves the formation of a new substance, while melting involves a state change.
O lonic compounds dissolve, while polar compounds melt.
O Polar compounds dissolve, while ionic compounds melt.
O Dissolution involves a state change, while melting involves the formation of a new substance.

Answers

The statement which best describes the difference between dissolution and melting is that dissolution involves the formation of a new substance, while melting involves a state change and is denoted as option A.

What is Dissolution?

This is the process in which a solute dissolves in a solvent such as water to form a solution thereby resulting in a new substance being created.

Melting on the other hand is the process in which a solid phase is changed into a liquid phase with the application of heat which makes the atoms move more freely.

This is therefore the reason why option A was chosen as the most appropriate choice.

Read more about Dissolution here https://brainly.com/question/16818744

#SPJ1

5
A yo-yo have the most potential energy at
Its:
A Highest point
B Lowest point
C Midpoint

D Top speed

Answers

Answer:

a. highest point

The answer is:
A. Highest point

Consider the pka of phosphoric acid (h3po4), the catalyst used in this reaction. could acetic acid be used as a catalyst in the reaction instead of phosphoric acid? explain why or why not. (3 pts)

Answers

Phosphoric acid has emerged as a novel chiral Brønsted acid catalyst since 2004. Chiral Brønsted acid protonates imines, thereby forming iminium salt bearing a chiral counter anion, and directs the attack of the nucleophile to the iminium salt.

What is Phosphoric acid?

With the chemical formula H3PO4, phosphoric acid, also known as orthophosphoric acid, monophosphoric acid, or phosphoric(V) acid, is an inorganic solid that contains phosphorus. Colorless and odorless, phosphoric acid is a substance. In its most common form, an 85% aqueous solution, it appears as a syrupy liquid that is colorless, odorless, and non-volatile. Considering that many fertilizers include it, it is a significant industrial chemical.

Acid makes up the substance. The phosphate ion PO results from the removal of all three H+ ions. H2PO, or hydrogen phosphate, is produced when one or two protons are removed, correspondingly. Organophosphate esters are produced by phosphoric acid.

To learn more about Phosphoric acid from the given links:

https://brainly.com/question/27983519

#SPJ4

Is the pressure of an ideal gas directly proportional to its absolute temperature?

Answers

The pressure of an ideal gas is directly proportional to its absolute temperature.

How are pressure of an ideal gas and temperature related?

The pressure of an ideal gas  is directly proportional to absolute temperature at constant volume.The volume of a gas is also directly proportional to it's absolute temperature at constant pressure.

When a constant volume of gas is held, the pressure of gas increases as the temperature increases. Mathematically it can be expressed as:

                                P∞T

In order to remove proportionality sign an equal sign is introduced with a proportionality constant 'K',thus the equation becomes

                                P=KT

On dividing both sides of above equation by T , equation becomes

                                 P/T=K

When a plot of pressure versus temperature is plotted a straight line graph is obtained passing through the origin.

To know more about pressure-temperature relation of ideal gas click here:

https://brainly.com/question/1190311

#SPJ4

What are the key factors that determine the stability of a nucleus? select all that apply.

Answers

The key factors  that determine the stability of a nucleus are neutron /proton ratio and  total number of nucleons in the nucleus.

How to determine nuclear stability?

Nuclear stability is determined by neutron/proton ratio and the total number of nucleons.Stable nuclei with atomic numbers up to 20 have neutron/proton ratio  of about 1/1.

For elements above atomic number 20 the number of neutrons is always greater than the number of protons which are  present along with neutrons in the nucleus of an atom.Such atoms are called stable isotopes.

No nucleus having number of nucleons greater than 208 is stable. This arises due to the fact when the nuclear force becomes 100 times , it operates only on very short distances .

When the nucleus attains a certain size,the strong force of attraction is no longer capable of holding the nucleus together.

To learn more about nuclear stability click here:

https://brainly.com/question/13751780

#SPJ4

A 100 gram gold nugget contains 5 grams of gold. what is the percentage of gold in the nugget?

Answers

A 100 gram gold nugget contains 5 grams of gold.

Then Percentage of gold in the gold nugget is

(5/100)*100 =5%.

What is Percentage ?

A % in mathematics is a quantity or ratio that is stated as a fraction of 100 (from the Latin per centum, "by a hundred"). Although the abbreviations "pct.", "pct.", and occasionally "pc" are also used, the percent symbol, "%," is frequently used to indicate it. A % lacks dimensions and has no associated unit of measurement.

If there are 50 male pupils for every 100 overall students in the class, 50 of them will be male. There are 250 male students out of 500 total.

Long before the decimal system was developed, computations were frequently done using fractions that were multiples of one hundred.

To learn more about Percentage from the given link:

brainly.com/question/28269290

#SPJ4

What is the angle between the sulfur-bromine bonds? (if there is more than one angle, pick the smallest.

Answers

The angle between sulfur-bromine bonds in SBr6 is 90°.

Sulfur hexabromide(SBr6), is a chemical compound with the hybridization of one s orbital, three p orbitals, and two d orbitals.

Hence, the hybridization of the central atom i.e, Sulfur in this compound is sp3d2.

As the compound has a hybridization of sp3d2, its shape is octahedral, as shown in the adjoining image.

As it is visible from the structure of SBr6, all angles between Sulfur and bromine are equal and their value is 90°.

Thus, the angle between sulfur-bromine bonds in SBr6 is 90°.

To know more about "hybridization of central atom", refer to the following iink:

https://brainly.com/question/13959501?referrer=searchResults

#SPJ4

A solution of dispersant is made by taking 15.0ml of a 50.0 mg ml -1 solution of tween 80 and mixing it with 50.0 ml of water. calculate the final concentration of the tween 80 in this solution

Answers

In terms of grammes per millilitre, the final Randyne concentration was 0.011 g/mL.

Knowing that C1V1 = C2V2 means that C1 and C2 are the concentrations of solutions 1 and 2, respectively.

V1 and V2 are, respectively, the volumes of solutions 1 and 2.

We obtain - mg/mL by substituting the given values.

The final concentration of the solution is 0.11 g/ml.

What is a solution?

A solution is a uniform mixture of two or more components with particles smaller than one nanometer. There are many different types of solutions, such as soda water, salt-and-sugar solutions, and others. In a solution, each component appears as a separate phase.There is particle homogeneity, or a uniform distribution of the particles. This explains why a soft drink bottle's entire contents have the same flavour.

In terms of grammes per millilitre, the final Randyne concentration was 0.011 g/mL.

Knowing that C1V1 = C2V2 means that C1 and C2 are the concentrations of solutions 1 and 2, respectively.

V1 and V2 are, respectively, the volumes of solutions 1 and 2.

We obtain - mg/mL by substituting the given values.

In terms of grammes per millilitre, the final Randyne concentration was 0.011 g/mL.

To learn more about solution from the given link below,

https://brainly.com/question/20388765

#SPJ4

Azt, used in the treatment of aids, has the following structure. what is the molecular formula for azt? c9h14n5o4 c9h9n5o4 c9h12n5o4 c10h13n5o4 c11h12n5o4

Answers

Hence , the molecular formula for azt is C₁₀H₁₃N₅o₄ which is option (d) .

The full type of nucleoside reverse transcriptase inhibitor may be azidothymidine that is additionally known as as AZT is a sort of drug that is employed to delay the event of AIDS within the patients that area unit laid low with HIV(human immunological disorder virus). The cluster of medicine from wherever nucleoside reverse transcriptase inhibitor belongs is thought as glycoside polymerase inhibitors.The formula is associate in nursing expression that defines the amount of atoms of every component in one molecule of a compound.It shows the particular variety of every atom in a very molecule.

The molecular formula for azt is C₁₀H₁₃N₅o₄

In this formula, there area unit 10 carbon atoms and 13 H atoms and 5 nitrogen atoms and 4 oxygen atoms within the given compound.

Learn more about moelcular formula here :

https://brainly.com/question/20442936

#SPJ4

Which is not evidence of a chemical change?

New odor present

Gas forming

boiling water

Bright light emitted

Answers

Answer:

Boiling Water

Explanation:

Boiling water is a physical change because the gaseous water produced is chemically identical to the liquid water i.e both of them have the same molecular structure of the water

Other Questions
seven caculators cost $170.00 According to the data presented in the map, which of the following conclusions can be drawn about the population distribution in Pakistan? Pakistan has a low physiological density. Arithmetic density is highest in major cities. Agricultural density is highest in the southwest region. Population density is concentrated in mountainous regions. Physiological density is highest in the northeast. Describe the nucleus in a eukaryotic cell. An inductor is connected to an ac supply. increasing the frequency of the supply _________ the current through the inductor. Explain why you need to vertically align the decimal points when summing decimal numbers. At the north campus of a performing arts school, 30% of the students are music majors. At the south campus, 80% of the students are music majors. The campuses are merged into one eastcampus. If 65% of the 1000 students at the east campus are music majors, how many students did each of the north and south campuses have before the merger? Which functional group, if found in the r group of an amino acid, would most likely be able to form an ionic bond force with a charged amino group on another molecule?. Determine whether the events are mutually exclusive or not mutually exclusive. Then find the probability. Round to the nearest tenth of a percent, if necessary.drawing an ace or a heart from a standard deck of 52 cards For a second order reaction, the initial reactant concentration, [a]o, is 0.93 m. after 16.7 s, the concentration is 0.65 m. what is [a] after 84 s? Place these words in the correct order based onthe most gravity to the least gravity.UniverseMoonPlanetGalaxyStar Juan's professor lectures on the fact that certain features in animals have been passed down from one generation to another. what theory is juan's professor probably describing? If you have three junit test methods written in the same testing class and the first one fails its assertions, will he other methods still be executed? A bakery is making whole-wheat bread and apple bran muffins. for each batch of break they make $35 profit. for each batch of muffins, they make $10 profit. the break takes 4 hours to prepare and 1 hour to back. the muffins take 0.5 hours to prepare and 0.5 hours to bake. the maximum preparation time available is 16 hours. the maximum bake time available is 10 hours. let x = Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA In civil rights literature, which ideology was often at odds with multiculturalism? A. Disillusionment B. Symbolism C. Disenfranchisement D. Black Power Based on what you know of the peptide bonds that link together amino acid residues, why would proline's side chain reduce the flexibility of the backbone? What are "affiliates" asKing uses the word?Consider the context of how the word is used multiple times in paragraph 2. The frequency of a microwave signal is 9.76 ghz. what is its wavelength in meters? help me asap im in a dba back to basics exam and didnt study Imagine that an employer purchases a health insurance plan that costs $365 per month, but requires that the employee pay $35 per month toward the cost of the plan. If the employee's salary is