T/F a peripheral nerve passes from the spinal cord into the limbs

Answers

Answer 1

True. A peripheral nerve passes from the spinal cord into the limbs.

What do you mean by spinal cord?

The spinal cord is a long, thin bundle of nerves that runs from the base of the brain down to the lower back. It is the main conduit for information between the brain and the rest of the body. It carries nerve signals to and from the brain and is responsible for relaying information about sensation and movement. It also plays a role in controlling involuntary body processes such as breathing, heart rate, and digestion.

Peripheral nerves are the nerves that connect the central nervous system (CNS) to the limbs and organs of the body. They pass from the spinal cord, which is part of the CNS, into the limbs and organs. These nerves carry both sensory and motor signals from the CNS to the limbs and organs, and vice versa. This allows the CNS to control movement, sense touch, and regulate organ functions.

To know more about spinal cord,

https://brainly.com/question/12187861

#SPJ4


Related Questions

Did Jamie cheat on Claire with Malva?.

Answers

Claire and Jamie stop having children after Brianna. By the end of the second season/book, Claire is walking across the stones while carrying Brianna.

Faith Fraser, Claire and Jamie's firstborn, passed away while still in the womb. She gave birth in Paris, France, following a precarious pregnancy. She was laid to rest in the Hospital des Agnes cemetery by Mother Hildegarde. Faith was the stillborn child in France. Jamie was never allowed to meet Mother Hildegarde, who baptized the child despite it being against the law. While he was in the Bastille, Claire was on the verge of passing away from childbed fever. Master Raymond rescued her from that. Brianna was born in 1948, despite being conceived in 1746. Brianna didn't discover the truth until after Frank had passed away, but she was the child Frank would raise for the length of her youth as his own.

Learn more about Jamie here:

https://brainly.com/question/30099448

#SPJ4

How are ultraviolet light and the ozone layer connected?

a. Ultraviolet light destroys the ozone layer

b. Ultraviolet light and ozone are not connected

c. Ultraviolet light reactions rebuild the ozone layer

d. ultraviolet light disrupts cloud formation - limiting the ozone layer

Answers

Option a. Ultraviolet light destroys the ozone layer describes the connection of  ultraviolet light and the ozone layer

Ultraviolet (UV) light is a type of electromagnetic radiation that exists in the spectrum of light between visible light and X-rays. The ozone layer is a region of the Earth's stratosphere that contains a high concentration of ozone (O3) molecules, which protects the Earth's surface from the harmful effects of UV radiation.

When UV light reaches the ozone layer, it can cause the ozone molecules to break apart, resulting in a decrease in the overall amount of ozone in the atmosphere. This process is known as ozone depletion. The destruction of ozone is caused by UV-B light and man-made chemicals such as chlorofluorocarbons (CFCs) that release chlorine and bromine atoms that are highly reactive to ozone.

Learn more about ozone layer here:

https://brainly.com/question/13253026

where is the crater from the asteroid that killed the dinosaurs

Answers

Answer:

it's Chicxulub crater

Explanation:

good luck hope it helps

How will the offspring be affected if one of the gametes carry an impaired number of haploid chromosomes?.

Answers

The offspring will suffer if one of the gametes or one of the parents has an abnormally low number of haploid chromosomes. This may result in a number of different genetic problems.

Trisomy occurs when a gamete with two copies of a chromosome fuses with a normal gamete during fertilization; monosomy occurs when a gamete with no copies of a chromosome fuses with a normal gamete during fertilization. In both humans and other animals, autosomal monosomy usually results in death.

Normally, the gamete or zygote will be discarded. It will either die shortly after birth or be susceptible to various genetic changes if it survives the gestation period. In sexually reproducing animals, the gametes have half as many chromosomes as the parents do.

Learn more about gametes :

brainly.com/question/2569962

#SPJ4

genes that are likely inherited together due to their physical proximity is called ?

Answers

Genetic linkage describes a group of genes that are likely to inherit together because they are close together.

The alleles of genes that are together on a chromosome are more likely to be handed down as a pair. Genes that are sufficiently close to one another on a chromosome have a propensity to "remain together." The phrase for this phenomenon is genetic linkage.

Physical proximity between two genetic markers makes it less difficult for them to be split off onto distinct chromatids during chromosomal crossover, and as a result, they are considered to be more connected than markers that are physically far apart.

In other words, the lower the likelihood of recombination between two genes, and the higher the likelihood that they will be inherited together, the closer they are to one another on a chromosome.

To learn more about Genetic linkage, refer

https://brainly.com/question/22173626

#SPJ4

The human body contains as many as 1 ______ neurons.

Answers

The human body contains as many as 1 trillion neurons. A neuron, also known as a nerve cell, is the fundamental unit of the nervous system.

How many neurons are in the human body?

Azevedo and others  found that the average adult male brain weighs 1.5 kg and has 86 billion neurons and 85 billion semi cells, which are only 7 and 24% less than expected.

Is there more than one cell body in a neuron?

Parts that make up a neuron. Like other cells, each has a soma, or cell body, that contains the nucleus, smooth and rough reticulum, Golgi, mitochondria, and other cellular components.

How many neurons are produced each day?

During adulthood, your hippocampus actually produces approximately 1400 neurons per day of new brain cells. This was first noticed by scientists in the 1960s, but the idea that the adult brain could make new neurons (called neurogenesis) wasn't widely accepted until the 1990s and remained contentious for decades.

Incomplete question :

The human body contains as many as 1 ___ neurons.

a) million

b) billion

c) hundred thousand

d) trillion

Learn more about Neurons :

brainly.com/question/13061744

#SPJ4

In animal cells, a pair of small cylindrical structures composed of microutubules that duplicate during interphase and move to opposite ends of the cell during prophase.

Answers

Answer: Those would be the centrioles, where spindle fibers are released during metaphase.

Hope this helps :)

Explanation:

which observation suggests that eukaryotes may share a more recent common ancestor with bacteria than with archaea?

Answers

Many yeast metabolism-related genes resemble bacterial genes more so than archaeal genes, which is a discovery that shows eukaryotes and bacteria may have had a more recent common ancestor.


The majority of the genes in eukaryotic genomes come from bacteria. 56% of eukaryotic genes are on average from bacteria, 53% come from eukaryotes without plastids, and 61% come from photosynthetic eukaryotic lineages, where the cyanobacterial ancestor of plastids contributed more genes to the eukaryotic lineage. In order to adapt to the nutrient-rich environment of the cells they infect, intracellular parasites go through a process of reductive evolution in which they give up bacterial genes involved in metabolic functions. The human parasite Encephalitozoon intestinalis, which has 86% genes of archaeal and 14% of bacterial origin, exhibits the most dramatic adaptive gene loss.


To learn more about eukaryotes from the link: https://brainly.com/question/30335918


#SPJ4


The complete question is:

Which observation suggests that eukaryotes may share a more recent common ancestor with bacteria than with archaea?

Many genes that affect metabolism in yeast are more similar to bacterial than archaeal genes.Bacteria have circular chromosomes.Bacteria are unicellular.Bacteria have peptidoglycan in their cell wall.Bacteria do not have a nuclear envelope.Archaeal membranes contain branched isoprene chains.

Which layer of earth's atmosphere is most strongly affected by conditions on the sun's surface?.

Answers

The thermosphere layer of the earth is most affected by conditions on the surface of the sun.

What layer of the atmosphere is the sun's greatest influence on?

The thermosphere is a region where temperatures once more increase with height and is situated above the mesopause. The intense UV and X-ray radiation from the sun has been absorbed, causing this increase in temperature.

Which atmospheric layer is most impacted by the weather?

Troposphere. This region, which is frequently referred to as the lower atmosphere, is where most weather occurs. The troposphere extends from the surface of the Earth to a height of 4 to 12 miles (6 to 20 km).

To know more about thermosphere layer visit:-

https://brainly.com/question/12224909

#SPJ4

How does the atomic number affect the elements properties?.

Answers

Chemical properties of an element are determined by its atomic number. Bonding and other chemical properties are determined by the number of electrons in an atom. The number of electrons in a neutral atom is equal to the atomic number Z.

A nucleus and electrons that orbit the latter make up an atom. The number of protons (atomic number) in the nucleus, which consists of protons with a positive charge and neutrons without a charge, defines the chemical composition of the atom (element type). Each element has special qualities all its own. Each has a unique atomic number and mass number due to the varied amounts of protons and neutrons it contains.

Learn more about Atomic Number

brainly.com/question/13464692

#SPJ4

Where are ADA enzymes?.

Answers

Adenosine deaminase is produced using instructions from the ADA gene.

All cells produce this enzyme, but the immune system's lymphocytes—which form in lymphoid tissues—create the most adenosine deaminase. The thymus, a gland found behind the breastbone, and lymph nodes, which are present all over the body, are examples of these lymphoid structures. The immune system, which protects the body from potentially hazardous intruders like viruses and bacteria, is made up of lymphocytes.

The adenosine deaminase enzyme's job is to get rid of the deoxyadenosine molecule that is produced when DNA is broken down. Deoxyadenosine, which is hazardous to lymphocytes, is changed into the harmless deoxyinosine by the enzyme adenosine deaminase.

To learn more about ADA enzymes click here:

https://brainly.com/question/30277919

#SPJ4

What factors cause leaves to change color?.

Answers

Autumn leaf color is influenced by three factors:

Pigments found in leavesDuration of the nightThe weather

The calendar controls the timing of color changes and the onset of falling leaves as the nights grow longer. None of the other environmental influences, such as temperature, rainfall, and food supply, are as consistent as the increasing length of night during autumn. As the days shorten and the nights lengthen and cool, biochemical processes in the leaf begin to paint the landscape with Nature's autumn palette.

A color palette requires pigments, and three types are present in autumn color: carotenoids, anthocyanin, and chlorophyll.

Throughout the growing season, chlorophyll and carotenoids are found in the chloroplasts of leaf cells.

To know more about leaves click here,

https://brainly.com/question/14949275

#SPJ4

in 2-3 sentences, describe how the bird population changed over the 5 years of feeding and reproducing.

Answers

The bird population may have changed over the 5 years of feeding and reproducing ide to an environmental constraint that led to the increase of adaptive alleles in the new environmental conditions.

What are adaptive alleles?

Adaptive alleles can be defined as gene variants that are present in the original population and they can increase their frequency in presence of a new environmental condition and or factors.

Therefore, with this data, we can see that adaptive alleles can dramatically increase the frequency in a population in response to changes in the environmental conditions.

Learn more about adaptive alleles here:

https://brainly.com/question/16103508

#SPJ1

The interaction of which two systems provides the molecules needed for the metabolic activity that takes place at ribosomes?.

Answers

Digestive and circulatory are the two systems provides the molecules needed for the metabolic activity that takes place at ribosomes.

What are Ribosomes?

A ribosome is a sophisticated molecular engine found inside living cells that synthesises proteins from amino acids, also known as translation. All live cells undertake protein synthesis, which is one of their fundamental functions.

Both prokaryotic and eukaryotic cells contain ribosomes, which are specialised cell organelles. Ribosomes are essential for the creation of proteins in every live cell.

The messenger ribonucleic acid (mRNA) that this cell organelle binds to carries information that is decoded by the mRNA's nucleotide sequence. They enter the ribosome at the acceptor site and transfer RNAs (tRNAs) that contain amino acids. Once it is attached, it continues to add amino acids to the tRNA's expanding protein chain.

Learn more about ribosomes here: https://brainly.com/question/13482257

#SPJ4

The sodium-potassium pump is involved in establishing the resting membrane potential.T/F

Answers

True. A resting membrane potential is established by the sodium-potassium pump.

How does a membrane potential get established by the sodium-potassium pump?

The Na+/K+ pump converts three internal Na+ ions into two external K+ ions using the energy with one ATP molecule (Glitsch, 2001).As a result, the pumps is electrogenic and hyperpolarizes the membrane potential by extruding 1 net charge every cycle.

What function would the Na +- K+ pumps have in ion flow?

The Na+/K+-pump is indeed an active transporter it moves both ions across the nerve cell membrane against concentration gradients using ATP hydrolysis as just an energy source. It performs specialized tasks related to the production of the nerve impulse as well as the upkeep of other active transport.

To know more about membrane visit:

https://brainly.com/question/26872631

#SPJ4

which characteristic is a strength of epidemiological studies?

Answers

The characteristic strength of epidemiological studies are that it can narrow down the list of possible causes and raise questions to pursue through other types of studies.

Epidemiological studies refers to the research based study which helps in identification and distribution of specific diseases in a given population. Epidemiology involves collection of data, and a systematic study through which relations and its effect are set. The population is selected through survey and no random sampling is done. It is important to know about the disease and the kind of population taken in the study before actually performing any research/ experiment. The major disadvantage of this study is lack of control on the variables whose effect or value may change with the changing environment.

Learn more about epidemiological studies at:

brainly.com/question/28238114

#SPJ4

5. Describe how a warming climate could affect baby Ringed Seals.​

Answers

Early warming causes pups to separate prematurely from their mothers.

what would be the dependent and independant variable

Answers

Both dependent and independent variable are found in an experiment.

What is  dependent and independent variable?

An independent variable is a variable that is being manipulated in an experiment or study to observe its effects on another variable. The independent variable is changed by the researcher to determine its impact on the dependent variable.

A dependent variable is a variable that is being measured or observed in an experiment or study in response to changes in the independent variable. The value of the dependent variable depends on the value of the independent variable. It is the variable being affected by the changes made to the independent variable.

Learn more about independent variable:https://brainly.com/question/29430246

#SPJ1

in the process of neurotransmission, the action potential causes neurotransmitters to be released from the ______________ into the _______________.

Answers

In the process of neurotransmission, the action potential causes neurotransmitters to be released from the synaptic vesicles into the synapse.

Neurotransmission is an essential process in biology, allowing the communication between neurons in the brain and body.

In this process, action potentials cause neurotransmitters to be released from synaptic vesicles into the synapse, where the neurotransmitter binds to a receptor on the postsynaptic cell.

This binding triggers a response in the postsynaptic cell, either excitatory or inhibitory.

This neurotransmission process is the basis of communication in the nervous system, and is an essential part of how our bodies and brains work.

Neurotransmission is the process by which information is passed from one neuron to another. In this process, an action potential is generated, triggering the release of neurotransmitters from synaptic vesicles into the synapse.

To learn more about synapse, click here:

https://brainly.com/question/27381250

#SPJ4

T or F A plant does not need its seed once it has leaves

Answers

Answer:

true

Explanation:

Who studied inheritance of traits in pea plants?.

Answers

Gregor Mendel studied inheritance of traits in pea plants.

Mendel created three laws of inheritance that characterised the transfer of genetic features through pea plant breeding before anybody knew what genes were. Peas are readily cultivated in great quantities, and their reproduction may be controlled. Peas also have male and female reproductive organs, allowing them to self-pollinate in addition to cross-pollinate. Mendel is regarded as the father of genetics because to his seminal work on heredity in pea plants 150 years ago. Mendel launched a series of experiments just at monastery in 1856 to discover how features are handed down through the generations. It was considered at the time that the qualities of the parents were merged together in their offspring.

Mendel examined pea inheritance (Pisum sativum). He picked peas because they had previously been used in comparable trials, they are easy to cultivate, and they can be seeded every year. Pea blooms have both male and female components, known as stamen & stigma, and self-pollinate. Self-pollination occurs even before flowers open, resulting in offspring from a single plant.

To know more about the Mendel study pea plants, here

https://brainly.com/question/19601954

#SPJ4

What is the name of the process that converts RNA into amino acids chains and then proteins?.

Answers

A protein is created through the process of translation from the data included in a messenger RNA molecule (mRNA). Then the so-called start codon of the mRNA sequence attaches to a transfer RNA (tRNA) molecule carrying the amino acid methionine.

As DNA cannot leave the nucleus, the mRNA messenger carries the DNA code dictating the amino acid sequence to the protein synthesis machinery (ribosomes). Transcription is the process of creating mRNA that carries the DNA's message. The translation is the process of creating protein molecules with an amino acid sequence that matches the coding found in mRNA. The information in the messenger RNA is read and then the respective amino acid sequence is synthesized which forms the final protein product.

To know more about translation, please visit

https://brainly.com/question/16746467

#SPJ4

Sunlight is reflected, absorbed, and transmitted by earth's atmosphere. Which are the chief constituents of the electromagnetic energy that reaches earth's surface? select the two correct answers.

Answers

The atmosphere of Earth reflects, absorbs, and transmits solar radiation. Ultraviolet light and visible light are the main components of the electromagnetic energy that reaches the surface of the Earth.

The three main atmospheric components that absorb radiation are ozone, carbon dioxide, and water vapor. Most ultraviolet, X-, and gamma rays, which have shorter wavelengths than visible light, are absorbed by the earth's atmosphere. If high energy X- and gamma rays were to strike the earth's surface directly, the organisms and cells of beings would be harmed. The ozone layer, which is higher up in the stratosphere, absorbs solar ultraviolet radiation and influences how much heat from the sunlight is reflected back into space. We are protected by the ozone layer from the damaging effects of too much UV radiation, which can cause sunburn, skin cancer, and eye damage.

To learn more about sun light click here     https://brainly.com/question/28613538

#SPJ4

DNA Never leaves the Nucleus of the cell. This is why you need RNA. In Transcription, DNA is
transcribed into a strand of RNA.
DNA has Adenine, Thymine, Cytosine, Guanine
RNA has Adenine, Uracil, Cytosine, Guanine
Transcription of DNA to RNA
ATGCCTAAGCCGTGTCCGAT

Answers

Answer:

Transcription and translation are the processes by which cells read or express the genetic instructions encoded in their DNA. Because multiple identical RNA copies may be produced from the same gene, and each RNA molecule can drive the creation of many similar protein molecules, cells can swiftly create a vast amount of protein when needed. However, each gene may be transcribed and translated with varying degrees of effectiveness, allowing the cell to produce massive amounts of some proteins while producing minute amounts of others (Figure 6-3). Furthermore, as we will learn in the following chapter, a cell may adjust (or regulate) the expression of each of its genes based on the demands of the moment—most visibly by managing RNA synthesis.

The leaves of a plant appear green because chlorophyll a. reflects blue light b. absorbs blue light c. reflects green light d. absorbs green light

Answers

Chlorophyll can absorb blue-violet and red regions of the visible spectrum when they photosynthesize using light. Since green is the color in which chlorophyll could not absorb, green light is reflected. As a result, the leaves of plant appear green.

what is chlorophyll?

Chlorophyll is pigment that gives plants their green color, and it helps plants create their own food through photosynthesis

It allow plants to absorb energy from light. Chlorophyll is responsible for green color of many plants and algae

In plants, chlorophyll is major photosynthetic pigment. The chloroplast contains great number of the chlorophyll pigments to absorb light energy. Some plants grow shoot that is green throughout. Examples are herbs that have abundant chlorophyll pigments not just in leaves but also on stems.

The green pigment chlorophyll is located within the thylakoid membrane, and space between the thylakoid and the chloroplast membranes is called stroma

learn more about chlorophyll at

https://brainly.com/question/18606966

#SPJ4

has an anticodon on one end and an amino acid on the other end?

Answers

An anticodon is a trinucleotide sequence that is complementary to a corresponding codon in a messenger RNA (mRNA) sequence and is found at one end of a transfer RNA (tRNA) molecule.

What contains both an anticodon and an amino acid?

The amino acids that tRNAs deliver to the mRNA are delivered in a specific order. This order is established by an attraction between a codon, which is a three-nucleotide sequence on the mRNA, and an anticodon, which is a complementary triplet of nucleotides on the tRNA.

What possess an anticodone and carries an amino acid?

Each tRNA contains the anticodon for a specific mRNA codon and carries the amino acid corresponding to that codon to the ribosomes during translation.

To know more about amino acid visit:-

brainly.com/question/28409615

#SPJ4

fungal organisms morphologically consistent with candida spp.

Answers

The hyphae are the vegetative form of filamentous fungi, which possess a thread-like structure. fungal organisms morphologically consistent with candida spp. refers to the infection.

There is a morphological consistency between the commensal lactobacillary flora, which includes species that are suppliers of candida organisms, and the fungi. According to the results of the repeat cotest, there is a derangement of species that are morphologically consistent with tumor-causing fungi. At the time of initial presentation, other risk factors are minimal. Instances of other non-neoplastic findings that are not prescribed Organisms Fungal organisms having plug-in flora-conforming morphology. the Vol. JMSCR Journal of Medical Science and Clinical Research. Candida is effectively not considered a sexually transmitted infection (STI). Thrush is a yeast infection that is always present and is not person-transmitted.

learn more about candida here

https://brainly.com/question/13251296

#SPJ4

What are the characteristics of a visceral reflex? Select all that apply.
-Voluntary
-Automatic
-Stereotyped
-Conscious
-Unconscious
-Unpredictable

Answers

Unconscious, Stereotyped and Automatic are the characteristics of a visceral reflex. reflex can be from birth or it may come in between.

Both visceral and somatic reflexes are possible. In visceral responses, internal organs like the heart, blood vessels, or GI tract structures respond glandurally or non-skeletally. For the purpose of eliciting their behaviours, they use neurons in the autonomic nervous system. The section on the autonomic nervous system has covered visceral reflexes in further detail. Somatic reflexes, on the other hand, entail motor reactions from the skeletal muscles that are not conscious. These reflexes accomplish so by using a few of the same lower motor neurons (alpha motor neurons) that are responsible for controlling skeletal muscle during conscious movement. Given how quickly they work, somatic reflexes make sense in that they frequently serve to keep us safe from harm.

learn more about visceral reflex here

https://brainly.com/question/29727145

#SPJ4

more than normal aging understanding mild cognitive impairment

Answers

Normal ageing and minor cognitive impairment are unquestionably two different things.

In general, moderate cognitive impairment refers to when a person exhibits observable symptoms of changes in their memory or way of thinking but is still able to carry out daily tasks. Mild cognitive impairment (MCI) is the stage that occurs between the normal aging-related decrease in memory and thinking and the more severe dementia-related decline. Problems with memory, language, or judgement may be a symptom of MCI. However, in general, the signs of cognitive deterioration brought on by ageing include: slower problem-solving and inductive thinking, reduction in spatial orientation, the slowing down of perception. From 6.7% of 60 to 64-year-olds to more than 25% of 80 to 84-year-olds, the prevalence of MCI increases with age.

To learn more about symptoms click here https://brainly.com/question/29628193

#SPJ4

Describe what will happen next after the neurotransmitter binds to the afferent neuron.

Answers

it can generally cause one of 2 types of receptors to be activated. It will ether activate a ligand gated ion channel or G-protein receptor
Other Questions
Evelyn ha $524. 96 in her checking account. She mut maintain a $500 balance to avoid a fee. She wrote a check for $32. 50 today. Write and olve and inequality that would be ued for the leat amount he need to depoit to avoid a fee identify a chronologically accurate statement about the history of texas from 1845 to 1866. What are angles 1 and 5 called?. martin luther king was best known for his philosophy of ___ Goods, services, and ideas can all be considered_____in the right circumstances, when consumers exchange something of value for them to satisfy their needs. FILL IN THE BLANK during__________a therapist will actively work with a person to uncover unhealthy patterns of thought and how they may be causing self-destructive behaviors and beliefs. earth and space chapter 19 section 1 review answer key why is atmosphiric pressure generally lower beneath a mass of warm rank these liquids by their expected surface tension. rank from greatest to least surface tension. to rank items as equivalent, overlap them. Miranda rights are required when:a. a suspect is being booked.b. a suspect is being questioned.c. a suspect is being arrested.d. a suspect is in custody and being questioned. There are 14 waiters working at a restaurant. One night, the mean tip the waiters received was $115.90. How much total in tips did the waiters collect that night?Enter your answer as a dollar amount, like this: $42.53 50 POINTS !!! Which are like terms in this expression? 13n 13 + 3/4n 1 3/4A. 13n and 13B. 13n and + 3/4nC. 13 and 3/4nD. + 3/4n and 1 3/4 What extended metaphordoes Frost use throughout hispoem?A. Frost compares a patch of old snow to anewspaperB. Frost compares a patch of old snow tosleepC. Frost compares a patch of old snow tothe rainD. Frost compares a patch of old snow tohappiness What are the main reasons of mutation stop codon?. calculate the number of kilowatt-hours (kw-hrs) consumed by an 850-watt window air conditioner turned on for four (4) hours. What is the two types of stretching?. How was Romanticism reflected in art?. What is a satellite. other things the same, the real exchange rate between american and chinese goods would be higher if What is one possible advantage of hearing the characters voices as opposed to silently?. the following partially completed worksheet contains lane co.'s reconciliation between financial statement income and taxable income for the three years ended april 30, 20x7, and additional information. determine the amounts omitted from the worksheet. select the amount from the provided values.