What is the answer ? How do you work this problem out ?

What Is The Answer ? How Do You Work This Problem Out ?

Answers

Answer 1

Check the picture below.

What Is The Answer ? How Do You Work This Problem Out ?

Related Questions

Give an example of a real-life situation where it might make sense to round a number and a different situation where it probably does not make sense to round a number.

Answers

Answer:

when dealing with money

Six more than the product of a number and 4 is equal to 7. Use the variable b for the unknown number

Answers

The value of the unknown number b is 1/4.

What is substitution ?

Substitution is putting a specific value in a given variable.

According to the given question Six more than the product of a number and 4 is equal to 7 and we have to use b for the unknown number.

7 is 6 more than the product of 4 and b which can be numerically expressed as

7 = 6 + 4b...(i)

7 - 6 = 4b.

1 = 4b.

b = 1/4.

To check if it is correct or not we will substitute the numerical value of b.

in eqn (i).

7 = 6 + 4b

7 = 6 + 4×1/4

7 = 6 + 1

7 = 7.

learn more about substitution here :

https://brainly.com/question/19516092

#SPJ1

Complete the process of solving the equation.
Fill in all the missing terms and select all missing descriptions.
4(-3d+14) = -17d + 16
-12d +56 = -17d + 16
+56 = 16
5d = -40
d=
Add 17d to both sides
Divide both sides by 5

Answers

Answer:

d = -8

Step-by-step explanation:

4(-3d+14) = -17d + 16

-12d + 56 = -17d + 16

+17d            +17d

5d + 56 = 16

      -56    -56

5d = -40

÷5      ÷5

d= -8

I hope this helps!

Cronus and Zeus are two competing cell phone companies. Cronus charges a flat rate of $8 per GB
of data. Zeus charges $3 per GB of data in addition to a monthly $10 fee that everyone pays
regardless of how much data they use. You expect to use between 0 GB and 8 GB of data each
month.
Part A: Graph the cost function associated with each company for data usage between 0 GB and 8
GB. Choose an appropriate scale for your graph.

Answers

The graph of the cost function is

Cost function refers to the functional relationship between cost and output. It studies the behavior of cost at different levels of output when technology is assumed to be constant.

Given: There are two companies Cronus and Zeus. Cronus charges a flat rate of $8 per GB of data. Zeus charges $3 per GB of data in addition to a monthly $10 fee that everyone pays. You expect to use between 0 GB and 8 GB of data each month.

Let y be the cost for data consumed.

Let x be Gb of data consumed.

Cost function of Cronus is y = 8x

Cost function of Zeus is y = 10+3x

Graph of both the companies is

where green line denotes the graph for Cronus and red line denotes the graph for Zeus.

To know more about cost function, visit: https://brainly.com/question/24020943

#SPJ9

PLEASE HURRY AND HELP. PLEASE AND THANK YOU

Answers

Answer:

Step-by-step explanation:

For each one you would take the Q1 and the Q3 value of the box and whisker plot and subtract them

Q3 - Q1 = IQR(interquartile range)

45 - 20 = 25

40 - 10 = 30

10 - 6 = 4

20 - 8 = 12

Answer quick I will mark brainlist

Answers

Answer:

Step-by-step explanation:

The Red circles have a probability of 1/2 of getting chosen, The red and blue circles together have an 100% chance of getting chosen because they are the total of circles. Np

Use the given minimum and maximum data​ entries, and the number of​ classes, to find the class​ width, the lower class​ limits, and the upper class limits. minimum equals 13​, maximum equals 94​, 6 classes

Answers

The minimum and maximum data​ entries is the to arrive at the values as follows:

The class width is solved to be 13lower class​ limits = 13, 26, 39, 52, 65, 78, 91upper class limits = 25, 38, 51, 64, 77, 90, 94

How to find the class​ width, the lower class​ limits, and the upper class limits

Given data

minimum equals 13​, maximum equals 94​, 6 classes

The class width

= ( maximum - minimum ) / 6

= ( 94 - 13 ) / 6

= 13.5

The class width is solved to be 13

Lower class​ limit

From the lowest 13,repeated addition of the class width gives the lower class limits as follows:

lower class​ limits = 13, 26, 39, 52, 65, 78, 91

Upper class limits

The upper class limit is gotten from the lower class limit by reducing one from the class width to get 13 - 1 = 12. This value is added to the lower class limits to get the upper class limits.

upper class limits = 25, 38, 51, 64, 77, 90, 94

Read more on class limits here: https://brainly.com/question/28183595

#SPJ1

Find a translation that has the same effect as the composition of translation.
(x,y)-> (x+8,y+4) followed by
(x,y)-> (x-7,y+8)

Answers

Answer:

you need to show the options at the bottoma

Step-by-step explanation en:

How do you write 2.74 x 10 to the negative 3rd power in standard notation?

Answers

Answer:

The exponent is -3, making it 10 to the power of negative 3. When an exponent is negative, the solution is a number less than the origin or base number. To find our answer, we move the decimal to the left 3 times:

2.74 ->0.00274

Step-by-step explanation:

Final Answer 0.00274

HELP PLEASE ASAP
i suck at math please help me

Answers

So you see how there’s a point at (1,2)? Well when x=1 y=2 so the value of the function when x=1 is 2

Answer:

2

Step-by-step explanation:

look at where x = 1 on the graph and see that there is a point at (1,2)

HELP WITH ALLL PLEASE LABEL THE NUMBERS :))

Answers

Answer:

18. in imge

19. is D

20. 10/3 (just divided by 5)

21. 8/7 bc negtive reciprocal

22. (0,8) y-int

Step-by-step explanation:

What is 2,443,802,280 rounded to the nearest ten million

Answers

Answer:2,440,000,000

Step-by-step explanation:

Answer is 2,440,000,000

Step by step
See attachment too

2,443,802,280
The “4” next to the “3” is the ten million place and is the key number that needs to round up or stay the same, depending on what we do with the 3.

The rule for rounding is if a number is 5 or bigger, the number next to it goes up. If the number is 4 or smaller, the number does not round up.

What is the value of 6×10 to the 15th power divided by 4×10 to the 12th power

Answers

Step-by-step explanation:

Click photo to look ans

MARK MEEEE AS A BRAIN LIST

Given 9.05(−13.2), find the product.

Answers

The value of the product 9.05(-13.2) is -119.46

How to determine the product?

The product expression is given as

9.05(-13.2)

Rewrite the product expression as

9.05(-13.2) = 9.05 * (-13.2)

Using a calculator, we have

9.05(-13.2) = -119.46

Hence, the value of the product 9.05(-13.2) is -119.46

Read more about product at

https://brainly.com/question/10873737

#SPJ1

Evaluate. Write your answer in fraction simple form.
(1/9)^2

Answers

Fraction potentiation

To calculate a fraction, it is almost the same as calculating a number normal to the power. The numerator and denominator of the fraction are multiplied as many times as possible indicated by its exponent, then:

    [tex]\boldsymbol{\sf{\left(\dfrac{1}{9}\right)^{2}=\dfrac{1\times1}{9\times9}=\cfrac{1}{81} }}[/tex]

Therefore the fraction 1/81 is already in reduced form, so it is no longer possible to simplify it.

Factor 2x^4-20x² - 78.​

Answers

2(x^2 - 13) (x^2 + 3)

Maria uses 2/3 cup of powdered mix for every 2 gallons of water. Franco uses 1 1/4 cups of powdered mix for every 5 gallons of water. What is the strength of each sports drink?

Answers

The strength ratio of each sports drink is 4:3.

What is ratio ?

Ratio can be defined as comparison of two or more similar quantities.

According to the given question Maria uses 2/3 cup of powdered mix for every 2 gallons of water.

Therefore the no. of cups of powdered mix per gallon in Maria's sports drink is

= (2/3)÷2

= (2/3)×(1/2)

= 2/6.

= 1/3 cups per gallon of sport drink.

In case of Franco the no. of cups of mix in his sport drink per gallon is

=(5/4)÷5

= 5/4×1/5

= 5/20

= 1/4 cups per gallon of sport drink.

∴ The strength of each sport drink is

= 1/3:1/4

= 12/3:12/4         ( LCM of 3,4 is 12 to remove the fractions)

= 4:3.

learn more about ratio here :

https://brainly.com/question/13419413

#SPJ1

1. For infant girls, the mean body length at 10 months is 72 centimeters with a standard deviation of 3 centimeters. The 75th percentile for a 10 month-old girl is ____ centimeters? (Round to one decimal place)

Answers

Using the normal distribution, the 75th percentile for a 10 month-old girl is 74 centimeters.

Normal Probability Distribution

The z-score of a measure X of a normally distributed variable with mean [tex]\mu[/tex] and standard deviation [tex]\sigma[/tex] is given by:

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

The z-score measures how many standard deviations the measure is above or below the mean. Looking at the z-score table, the p-value associated with this z-score is found, which is the percentile of X.

The mean and the standard deviation are given, respectively, by:

[tex]\mu = 72, \sigma = 3[/tex]

The 75th percentile is X when Z = 0.675, hence:

0.675 = (X - 72)/3

X - 72 = 3 x 0.675

X = 74.

The 75th percentile for a 10 month-old girl is 74 centimeters.

More can be learned about the normal distribution at https://brainly.com/question/15181104

#SPJ1

help like now and immediate

Answers

Answer: x=30

Step-by-step explanation:

6x-5+z-25=180

7x+210

x=30

54. The cone in the diagram has radius x cm and height 2x cm. The volume of the cone is 500 cm³. Find the value of x.​

Answers

Value of x is 6.2 cm when x is the radius of cone.

What is Volume of cone?

The amount of space occupied by a cone is referred to as the volume of a cone. The volume of the cone depends on the base radius of the cone and the height of the cone. It can also be expressed in terms of its slant height wherever necessary.

Volume of cone formula, V= 1/3*[tex]\pi[/tex]*r∧2*h

given,

Height h= 2x

radius = x

Volume V= 500cm3

V= 1/3*[tex]\pi[/tex]*r∧2*h

500 = 1/3 *22/7*x2*2x

x∧3 = 5*3*5*5*2*2*7/11*4

x∧3 = 5*3*5*5*7/11

x = ∛(5*3*5*5*7/11)

x = 5(∛21/11)

x = 6.2 cm

Therefore, the radius of the cone x is 6.2 cm

Read more about Volume of cone at :

https://brainly.com/question/1984638

#SPJ1

Across
Down
1. animal that eats only plants
2. warm-blooded animals with hair or fur
3. animal that is hunted and eaten
4. animals who hunt other animals
5. back teeth
8. sharp. curved nails on an animal's foot 6. animal that eats meat and plants
9. animal that eats only meat
7. front teeth

Answers

Answer:

1. Herbivores

2. Mammals

3. Prey

4. Predators

5. Molars

6. Omnivores

8. Claws

9. Carnivores

Help please, I need this done for extra credit

Answers

The value of 'x' in the given equation - 8 = - (x + 4) is 4.

What are equations?In its most basic form, an equation is a mathematical statement that shows that two mathematical expressions are equivalent. 3x + 5 = 14, for example, is an equation in which 3x + 5 and 14 are 2 different expressions separated by a 'equal' sign.

So, value of 'x' in - 8 = - (x + 4):

- 8 = - (x + 4)- 8 = - x - 4- 8 + 4 = -x-4 = -xSo, x = 4

Therefore, the value of 'x' in the given equation - 8 = - (x + 4) is 4.

Know more about equations here:

https://brainly.com/question/2972832

#SPJ1

The complete question is given below:

Find the value of x in the equation - 8 = - (x + 4).

*HELP*

Henrich is a single taxpayer. In 2021, his taxable income is $455,000. What is his income tax and net investment income tax liability in each of the following alternative scenarios? Use Tax Rate Schedule, Dividends and Capital Gains Tax Rates for reference. (Do not round intermediate calculations. Leave no answer blank. Enter zero if applicable. Round your final answers to 2 decimal places.)
a. All of his income is salary from his employer.
Income tax _______
Net investment income tax ______
Total tax liability __________

b. His $455,000 of taxable income includes $2,000 of long-term capital gain that is taxed at preferential rates.
Income tax _______
Net investment income tax ______
Total tax liability __________

c. His $455,000 of taxable income includes $49,000 of long-term capital gain that is taxed at preferential rates.
Income tax _______
Net investment income tax ______
Total tax liability __________

d. Henrich has $197,500 of taxable income, which includes $51,000 of long-term capital gain that is taxed at preferential rates. Assume his modified AGI is $210,000.
Income tax _______
Net investment income tax ______
Total tax liability __________

Answers

The Investment Income, if any (g) $380 and The Net Income tax payable is $41,516.75

How to find the Total Income tax?

A. The Taxable Income (a) $425,000  

The Prefrentially taxed income (b) $0  

The Income taxed at ordinary rates ( c) $425,000  

The Tax on c above (d)

$124,469.95 = $120,529.75 + [($425,000 - $415,050) x 39.6%]

The Tax on b above ( e) is $0  

Thus, the Total Income tax (f) is $124,469.95 (d + e)

The Investment Income, if any is $0 No Investment Income

The Net Income tax payable is $124,469.95  

B. The Taxable Income (a) $425,000  

The Prefrentially taxed income (b) $2,000  

The Income taxed at ordinary rates ( c) $423,000  

The Tax on c above (d);

$123,677.95 = $120,529.75 + [($423,000 - $415,050) x 39.6%]

The Tax on b above ( e) ;

$400 = $2,000 x 20%, Since marginal rate is 39.6%

The Total Income tax (f) $124,077.95 (d + e)

The Investment Income, if any (g) $76

($2,000 x 3.8% = $76)

The Net Income tax payable is $124,153.95 (f + g)

C. The Taxable Income (a) $425,000  

The Prefrentially taxed income (b) $55,000  

The Income taxed at ordinary rates ( c) $370,000  

The Tax on c above (d);

$105,629.25 = $46,278.75 + [($370,000 - $190,150) x 33%]

The Tax on b above ( e);

$8,747.50 [($45,050 x 15%) + ($9,950 x 20%)]

The Total Income tax (f) $114,376.75 (d + e)

The Investment Income, if any (g) $2,090

($55,000 x 3.8% = $2,090)

The Net Income tax payable $116,466.75 (f + g)

D. The Taxable Income (a) $195,000  

The Prefrentially taxed income (b) $50,000  

The Income taxed at ordinary rates is ( c) $145,000  

The Tax on c above (d);

$33,636.75 = $18,558.75 + [($145,000 - $91,150) x 28%]

The Tax on b above ( e);

$7,500.00 = $50,000 x 15%

The Total Income tax (f) is $41,136.75 (d + e)

The Investment Income, if any (g) $380

The Net Income tax payable is $41,516.75 (f + g)

LEarn more about the concept here;

https://brainly.com/question/15215359

#SPJ1

Fractions and mixed numbers

Answers

Check out the attached photo

The rectangular coordinate system shows the graph of the equations in a system of equations. Use the graph to determine the number of solutions for the system. If the system has only one​ solution, give its coordinates.

Answers

Answer:

  A.  The only solution is (-2, 1).

Step-by-step explanation:

Given a graph of two lines, you want the number of solutions to the system of equations the lines represent.

Solution

The graph of an equation represents all of the points that satisfy that equation. When a system of equations has more than one equation, the set of points that satisfies all of the equations is the set of points where the graphs intersect (overlap) each other.

Here, the two straight lines intersect at exactly one point: (-2, 1). That one point represents the only solution to the system of equations.

The only solution is (-2, 1).

At 6 AM, the temperature in New Crampton, California was 64℉. By 4 PM, the temperature had risen to 76℉. What was the change in temperature over the 10-hour period?

Answers

The change in temperature over the 10 hours using a mathematical operation, is 12℉.

What is a mathematical operation?

A mathematical operation uses input values (variables, numbers, mathematical operators, and operands) to determine an output value.

Some of the mathematical operators include addition, subtraction, division, and multiplication.

For instance, we can subtract the temperature in New Crampton at 6 A.M. from the temperature at 4 P.M. to determine the temperature change.

Data and Calculations:

The temperature at 6 A.M. in New Crampton = 64℉

The temperature at 4 P.M in the same city = 76℉

Change in temperature over 10 hours = 12℉ (76℉ - 64℉)

Thus, the change in temperature over the 10 hours using a mathematical operation, is 12℉.

Learn more about mathematical operations at https://brainly.com/question/20628271

#SPJ1

Jana baked some muffins. After she served 13 of them to her friends for brunch, she had 17 left. How many muffins did she bake?

Answers

Answer:

30

Step-by-step explanation:

Add 13 served to 17 left over to get how many muffins she originally baked.

Answer:

30

Step-by-step explanation:

served muffins=13

left muffins=17

13+17=30

What was the overall percent increase in the stadium capacity between 1920 and 2000

Answers

The overall percent increase in the stadium capacity between 1920 and 2000 considering the capacity was "x" in 1920 and "y" in 2000 is [tex][\frac{(y-x)}{x}*100][/tex].

As per the question statement, we are required to calculate the overall percent increase in the stadium capacity between the time period of 1920 and 2000. But no data about the stadium capacity is mentioned in the question statement. Hence, we will assume the capacity was "x" in 1920 and "y" in 2000. Assigning two variables to solve the question produces a generalized form of our required answer, in which, we can substitute any data to get the desired output.

Since Percentage change is calculated as

[{(Change from original)/(Original Value)}*100],

Our change in seating capacity of the stadium in 2000 from the year 1920 is [tex](y-x)[/tex] and original value being "x",

Overall percent increase in the stadium capacity between 1920 and 2000 is [tex][\frac{(y-x)}{x}*100][/tex].

Percent Increase: It is a measure of the difference (Increment) between the final value and the initial value, expressed in the form of a percentage.

To learn more about Percent Increase, click on the link below.

https://brainly.com/question/1075386

#SPJ9

Real-World Application

Answers

al-World Application0231651561065

(69 1/3)-(45 14/15)=

Answers

Answer:

-19

Step-by-step explanation:

1/3 of 69=23

14/15 of 45=42

23-42=-19

Answer:

23 2/5

Step-by-step explanation:

69 1/3 - 45 14/15

= (69 - 45) + (1/3 - 14/15)

= 24 + 1 x 5/3 x 5 - 14/15

= 24 + 5/15 - 14/15

= 24 + 5 - 14/15

= 24 + -9/15

= 24 + -9 ÷ 3/15 ÷ 3

= 24 + -3/5

= 23 2/5

Other Questions
Place these words in the correct order based onthe most gravity to the least gravity.UniverseMoonPlanetGalaxyStar Juan's professor lectures on the fact that certain features in animals have been passed down from one generation to another. what theory is juan's professor probably describing? If you have three junit test methods written in the same testing class and the first one fails its assertions, will he other methods still be executed? A bakery is making whole-wheat bread and apple bran muffins. for each batch of break they make $35 profit. for each batch of muffins, they make $10 profit. the break takes 4 hours to prepare and 1 hour to back. the muffins take 0.5 hours to prepare and 0.5 hours to bake. the maximum preparation time available is 16 hours. the maximum bake time available is 10 hours. let x = Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA In civil rights literature, which ideology was often at odds with multiculturalism? A. Disillusionment B. Symbolism C. Disenfranchisement D. Black Power Based on what you know of the peptide bonds that link together amino acid residues, why would proline's side chain reduce the flexibility of the backbone? What are "affiliates" asKing uses the word?Consider the context of how the word is used multiple times in paragraph 2. The frequency of a microwave signal is 9.76 ghz. what is its wavelength in meters? help me asap im in a dba back to basics exam and didnt study Imagine that an employer purchases a health insurance plan that costs $365 per month, but requires that the employee pay $35 per month toward the cost of the plan. If the employee's salary is What is the slope of the line that passes through the points (6,2) and (-18,2) If you had to choose one scene from Equianos story to turn into a visual illustration in order to capture his narrative, which one would it be and why? A 78-year-old man is admitted to the emergency department (ed) with bradycardia resulting from overdose of donepezil. the nurse knows that the ed is likely to order which medication? If you see a 1st quarter moon today, what will people on the other side of the earth see later today? What elected group's laws and regulations make laboratory safety a legal requirement in the united states of america? After administering medication to a client subcutaneously, the nurse removes the needle at the same angle at which it was inserted. which explains the nurse's action? Which atoms has smaller ionization energy What is the wavelength, in nanometers, of the bright line of the hydrogen emission spectrum corresponding to the following transition?. Why Is Decission Necesarry?