What is the solution to the following system of equations
7x+2y=24
8x+2y=30

Answers

Answer 1
#x=6, y=-9#
Explanation:
Subtract equation one from equation two
#x+o=6#
Put #x=6# into #7x+2y=24#
#=> 42+2y=24#
#2y=-18#
#y=-9#

Related Questions

Work out the size of angle 0.
Give reasons for your answer.

Answers

Answer:

θ = 56°

Step-by-step explanation:

As OA and OB are both radii, triangle AOB is an isosceles triangle:

⇒ m∠ABO = m∠OAB = 48°

Interior angles of a triangle sum to 180°:

⇒ m∠ABO + m∠OAB + m∠AOB = 180°

⇒ 48° + 48° + m∠AOB = 180°

⇒ m∠AOB = 180° - 48° - 48°

⇒ m∠AOB = 84°

Angles on a straight line sum to 180°:

⇒ m∠AOB + m∠DOB = 180°

⇒ 84° + m∠DOB = 180°

⇒ m∠DOB = 180° - 84°

⇒ m∠DOB = 96°

The tangent of a circle is always perpendicular to the radius.

Therefore, tangent BC is perpendicular to radius OB, and tangent DE is perpendicular to radius OD, so:

m∠OBC = 90°m∠ODE = 90°

OBCD is a quadrilateral.

The interior angles of a quadrilateral sum to 360°:

⇒ m∠OBC + m∠BCD + m∠CDO + m∠DOB = 360°

⇒ 90° + θ + 28° + 90° + 96° = 360°

⇒ θ + 304° = 360°

⇒ θ = 360° - 304°

⇒ θ = 56°

Calculate 7/12 + 4/20 - 2/6​

Answers

Answer:

9/20 or 0.45

Step-by-step explanation:

The least common multiple of 12, 20 and 6 is 60. Reducing the fractions to the denominator 60 we have:

[tex] \bold{ \dfrac{7}{12} + \dfrac{4}{20} - \dfrac{2}{6} = \dfrac{35}{60} + \dfrac{12}{60} - \dfrac{20}{60} } \\ \\ \bold{= \frac{35 + 12 - 20}{60} = \frac{27}{60} = \frac{9}{20} }[/tex]

If any addend is an integer, an I is placed as denominator and the same operation is done.

How do you express .13 as a percentage?

Answers

.13 can be expressed in the form of percentage as 13%.

In order to convert numbers in decimal into percentage we only need to multiply the given number with 100 and after multiplying the number with hundred it can be written in percentage form. Like in the question given number is 0.13 and we need to express this in form of percentage. So in order to express this number in percentage we just multiply it with 100 which will be equal to 13% i.e

0.13 x 100 = 13%

By multiplying a decimal value by 100 and adding the percentage (%) sign, you can turn a decimal value into a percentage. A decimal multiplied moves the decimal point two places to the right.

To know more about conversion of Decimal into Percentage,click here :

 https://brainly.com/question/1747660

#SPJ4

the monthly cost (in dollars) of a long-distance phone plan is a linear function of the total calling time (in minutes). the monthly cost for 45 minutes of calls is $14.40 and the monthly cost for 102 minutes is $19.53. what is the monthly cost for 66 minutes of calls?

Answers

The monthly cost for 66 minutes of calls will be $15.84.

Monthly cost is the payment or the bill amount that needs to be paid at the end of the month.

The monthly cost (in dollars) of a long-distance phone plan is a linear function of the total calling time (in minutes)

The monthly cost for 45 minutes of calls = $14.40

The monthly cost for 102 minutes = $19.53

The above values can be paired in groups so as to satisfies the coordinates of a linear function

(45,14.40)  and (102,19.53)

Finding the slope of the graph using these points

slope, m=Δy/Δx

m=Δy=19.53 - 14.40 = 5.13

Δx=102 - 45 = 57

m = 5.13/57 =0.09

Finding the equation of the linear function using m = 0.09, and point (45,14.40)

m=Δy/Δx

0.09=y-14.40/x-45

0.09(x-45)=y-14.40

0.09x-4.05=y-14.40

0.09x-4.5+14.40=y

y=0.09x + 9.9

So for 66 minutes, the cost will be;

x = 66, y = ?

y=0.09*66 + 9.9

y=5.94+9.9 = $15.84

The monthly cost for 66 minutes of calls is $15.84.

To know more about monthly cost,

https://brainly.com/question/13803307

#SPJ4

y varies directly with the square of x.
If x= 1/2 and y = 12, find x when y = 432.

Answers

Answer:

20.8

Step-by-step explanation:

y = x^2

Given the value of y = 432, the equation would be:

432 = x^2

x is found by finding the square root of 432

sqrt 432 = sqrt (x^2)

x = 20.8

Check:

20.8^2 = 432.64

Your final answer would be 20.8.

Using a variable, write an inequality to represent the solution shown on the graph below.

Answers

Answer: [tex]x\leq -1[/tex]

Step-by-step explanation: The closed point indicates that it can be equal to that number. The arrow is going back on the number line, meaning it is going to be less. Thus, it is less than or equal to -1.

Ok so we start with the direction it is going. Take any fully shaded in value by the line and compare it to the dot value, -1. This would yield it being less than -1. Then, the dog is shaded in meaning it INCLUDES the value of -1, so your inequality will be x <= -1 (that should be a less than or equal to symbol)

based on your site data sheet and your sample identification, do you feel that you determine an appropriate stream rating? (why or why not). do you feel using macroinvertebrates is a good method to evaluate stream conditions?

Answers

When collecting quantitative data you can use a statistical formula to give you a rough estimate of the sample size you will need. When collecting qualitative data, however, the rule of thumb is to have as representative of a sample as possible that will allow you to exhaust the knowledge you could learn from the population.

Macroinvertebrate sampling provides a relatively easy way to assess the water quality of a stream. The types and numbers of macroinvertebrates (mostly insect larvae/nymphs) that form the biological community at a particular stream location are shaped by both the nature of the stream and the quality of water that drains into the stream.

a digit is written to the right of the units digit of $757$. if the resulting four-digit number is divisible by $3$, how many possibilities are there for the digit that was written?

Answers

3, possibilities are there for the digit that was written.

What is unitary method ?

Area is the total amount of space that an object's shape or a flat (2-D) surface occupy.

Create a square on paper by using a pencil. Tw dimensions make it up. A shape's area on paper is the space it takes up.

Imagine that your square is made up of smaller unit squares.

The area of a figure is equal to the number of unit squares required to completely cover the surface area of a particular 2-D shape. Square cms, square feet, square inches, square meters, etc. are a few common units for measuring area.

To get the area of the square figures presented below, draw unit squares with 1-centimeter sides. Therefore, the shape will be measured.

According to our question-

Not a multiple of 3, 7+5+7+0=19

Not a multiple of 3, 7+5+7+1=20

Multiple of three: 7+5+7+7+2=21

Not a multiple of 3, 7+5+7+3=22

Not a multiple of 3, 7+5+7+4=23

Multiple of three: 7+5+7+7+5=24

Not a multiple of 3, 7+5+7+6=25

Not a multiple of 3, 7+5+7+7=26

7+5+7+8=27 multiple of 3

Not a multiple of 3, 7+5+7+9=28

learn more about unitary method click here:

brainly.com/question/24587372

#SPJ4

Please help, giving thanks and brainliest:) (Please give an explanation if possible and please dont give a fake answer)

Please answer all four questions (they are simple and go with the diagram)

Answers

(1) The measure of the angle CFD = 48°.

(2) The measure of the angle AFE = 48°.

(3) Pair of supplementary angles: Angle BFC and angle CFD.

(4) Pair of adjacent angles: Angle AFB and angle BFD.

What are the properties of angles?

The angle properties of lines are:

Vertically opposite angles are equal, for example, a = d, b = c.

Adjacent angles add to 180, for example, a + b = 180, a + c = 180. Corresponding angles are equal, for example, a = e, b = f, c = g, d= h.

(2) In the given figure, m∠BFC = 42°

By using the property of linear pair, we can write

       ∠BFC + ∠CFD = 180

         42 + ∠CFD = 180

        ∠CFD = 58.

(2) Angle CFD and angle AFE are opposite angles and opposite angles are same in measurement so we can write

             m∠AFE = 58°.

(3) Pair of supplementary angles: Angle BFC and angle CFD.

(4) Pair of adjacent angles: Angle AFB and angle BFD.

Hence,

(1) The measure of the angle CFD = 48°.

(2) The measure of the angle AFE = 48°.

(3) Pair of supplementary angles: Angle BFC and angle CFD.

(4) Pair of adjacent angles: Angle AFB and angle BFD.

To learn more about angle properties, visit:

https://brainly.com/question/12767194

#SPJ1

a certain acid has a ka equal to 5.57 x 10-5. determine the pkb of its conjugate base (give your answer to two decimal places)

Answers

The pk[tex]_b[/tex] of given acid conjugate base is 9.74 if k[tex]_a[/tex] of the same acid is equal to 5.57×10⁻⁵

The Bronsted-Lowry corrosive base hypothesis incorporates the ideas of form acids and form bases. At the point when a corrosive separates into its particles in water, it loses a hydrogen particle. The species that is shaped is the corrosive's form base.

A more broad definition is that a form base is the base part, X-, of a couple of mixtures that change into one another by acquiring or losing a proton. The form base can acquire or retain a proton in a synthetic response. The form corrosive gives the proton or hydrogen in the response.

In a corrosive base response, the substance response is:

Corrosive + Base ⇌ Form Base + Form Corrosive

We know very well that from equilibrium state theories that  pk[tex]_b[/tex] +pk[tex]_a[/tex] =14

where  pk[tex]_a[/tex] = - log( k[tex]_a[/tex] )

So, we have k[tex]_a[/tex] =5.57×10⁻⁵

Taking log of  k[tex]_a[/tex] ,we get

=>pk[tex]_a[/tex]= -log(5.57×10⁻⁵)

Using properties of logarithm, log(a × b)=log(a)+log(b)

=>pk[tex]_a[/tex]= -log(5.57) -log(10⁻⁵)

=>pk[tex]_a[/tex]= -0.745 +5

=>pk[tex]_a[/tex]=4.25

Therefore, from above written formula, we get

=>4.25+pk[tex]_b[/tex]=14

=>pk[tex]_b[/tex]=14-4.25

=>pk[tex]_b[/tex]=9.74

Hence, pk[tex]_b[/tex] value is 9.74

To know  more about conjugate base, visit here:

https://brainly.com/question/12883745

#SPJ4

I need help thanks for your help…

Answers

Answer: 2

Step-by-step explanation:

PLSSS HELP IF YOU TURLY KNOW THISS

Answers

Answer:

-3

Step-by-step explanation:

5 + ( -8 )

-8 - 5 = -3

so final answer: -3 because ( - 8 ) so the ( - ) would go on the answer

Answer: -3

Step-by-step explanation: It would be -3 because since we are adding a negative it would go toward the negative side. Also, it can be modeled as:

5 - 8

This would still = -3.

Undergraduates
Graduates
Total
University Data
Receiving
Financial Aid
4222
1879
6101
Not Receiving
Financial Aid
3898
731
4629
Total
8120
2610
10730
If a student is selected at random, what is the
probability that the student receives aid
(rounded to the nearest percent)? [? ]%

Answers

Step-by-step explanation:

a probability is always the ratio

desired cases / totally possible cases

in our case the desired cases are all students with financial aid : 6101

and the totally possible cases are 10730.

so, the probability to pick a student at random, who receives financial aid is

6101 / 10730 = 0.568592731... = 56.8592731...% ≈

≈ 57%

Is any additional information needed to show △≅△?

Answers

Answer:

No

Step-by-step explanation:

To prove 2 triangles an congruent we need three pieces of information

SSS or SAS or ASA or RHS

S - Side

A - Angle

R - Right angle

H - Hypotenuse

We have an angle side and another side

So these two triangles can be proved congruent by SAS

Hope this helped and have a good day

a committee of six people (four men and two women) need to select a chairman and secretary. they do so by drawing names from a hat. what are the probabilities that

Answers

The probability that they all are women is 0.0333 and that two of them are men is 0.50

There are 6 men and 4 women in your committee, that gives you a total of 10 people to choose from.

Without restrictions, there's a total of 10C3 ways to choose a subcommittee of 3 people.

a) A subcomitte of 3 people consisting of all women can be chosen in 6C0*4C3 ways.

So, the probability for the first problem is 6C0*4C3/10C3 = 0.0333

b) A subcommittee consisting of 2 men and 1 woman can be chosen in 6C2*4C1 ways.

So, the probability for this problem is 6C2*4C1/10C3 = 0.50.

Therefore, the probability that they all are women is 0.0333 and that two of them are men is 0.50.

To learn more about combinations refer here

https://brainly.com/question/11732255

#SPJ4

Disclaimer

the question given by you is incomplete, the answer is solved as per a similar question and the question is

A committee consist of six men and four women. A subcommittee is made by randomly choosing three of the committee members. What is the probability that: a. they are all women b. two of them are men?

if my overall grade is 44 percent and a test is worth 60 percent of that grade and i get 50 percent on a test what would my overall grade be now?

Answers

I believe your final mark would be 47.60% but some tests have sections worth more than others which could contribute to a different percentage

What is the length of AB

Answers

Answer: 11.5 maybe ? {sorry if its wrong]

Step-by-step explanation:

A theater seats 500 people. Each adult ticket, a, sells for $7.50, and each student ticket, s, for $4.50. On a Friday evening, every seat was filled, and the theater made $3,150 in ticket sales. Which system of equations could be used to find the number of adult and student tickets sold on Friday evening?


a + s = 3,150

7.5a + 4.5s = 3,150


a + s = 500

7.5a + 4.5s = 3,150


a + s = 3,150

7.5s + 4.5a = 500


a + s = 500

7.5a + 4.5s = 500

Answers

Answer:

The two equations that can be used are 7.50a + 4.50s = 3150, and

 a + s = 500.

----------------------

a + s = 3,150  NO

7.5a + 4.5s = 3,150 YES

a + s = 500    YES

7.5s + 4.5a = 500  NO

Step-by-step explanation:

We know that a + s = 500.

Total sales would be the product of the number of adult and student tickets times their repsective prices:

Total Sales ($) = $7.50a + $4.50s = $3150

Leaving off the units for the next steps, we have two equations and we can rearrange one of them to substitute into the other.  

1)   Rearrange the first equation to isolate a:  a = 500-s

Now use this definition of a in the second equation:

7.50a + 4.50s = 3150

7.50(500-s) + 4.50s = 3150

3750 - 7.5s + 4.50s = 3150

 -3s = -600

    s = 200  student tickets were sold

Use a+s=500 to find a:  

a+200 = 500

     a=300   300 adult tickets were sold.

================

The two equations we used to find this answer were:

7.50a + 4.50s = 3150, and

 a + s = 500

How do you find the nth term of the sequence 2,4,16,256,... ?

Answers

The [tex]n^{th[/tex] term of an exponentially increasing sequence can be found using the formula:

[tex]a_n = a_1[/tex] × [tex]r^(^n^-^1^)[/tex]

To find the [tex]n^{th[/tex] term of a sequence, you can use a formula that defines the relationship between the terms of the sequence. In this particular sequence, the terms seem to be increasing exponentially, with each term being the square of the previous term.

The [tex]n^{th[/tex] term of an exponentially increasing sequence can be found using the formula:

[tex]a_n = a_1[/tex] × [tex]r^(^n^-^1^)[/tex]

where [tex]a_n[/tex] is the nth term of the sequence, [tex]a_1[/tex] is the first term of the sequence, and r is the common ratio.

In this case, the first term is 2, and the common ratio is the previous term divided by the term before it. In this sequence, the common ratio is [tex]\frac{4}2=2[/tex]

Therefore, the [tex]n^{th}[/tex] term of the sequence can be found using the following formula:

[tex]a_n = 2[/tex] × [tex]2^{(n-1)[/tex]

So to find the [tex]n^{th[/tex] term, you would plug in the value of n into the formula. For example, to find the fifth term of the sequence, you would plug in 5 for n:

[tex]a_5 = 2[/tex] × [tex]2^{(5-1)[/tex]

= 2 × [tex]2^4[/tex]

= 2 × 16 = 32

So the fifth term of the sequence is 32

To learn more about sequence, visit:

brainly.com/question/21961097

#SPJ4

consider the curve defined by y2=x3−3x 3 for x>0. at what value of x does the curve have a horizontal tangent?

Answers

At x = 0 and x = 2, the curve defined by y² = x³ - 3x² has a horizontal tangent.

We have,

First, let's find the derivative of y with respect to x.

We can rewrite the equation as:

y² = x³ - 3x²

y = (x³ - 3x²)^(1/2)

Now, differentiating y with respect to x using the chain rule:

dy/dx = (1/2) * (x³ - 3x²)^(-1/2) * (3x² - 6x)

Next, we set the derivative equal to 0 to find the values of x where the curve has a horizontal tangent:

(1/2) * (x³ - 3x²)^(-1/2) * (3x² - 6x) = 0

We can disregard the constant factor of (1/2) since it doesn't affect the solution.

Thus, we have:

(x³ - 3x²)^(-1/2) * (3x² - 6x) = 0

To have a horizontal tangent, the slope of the curve should be 0, which means the derivative is equal to 0.

Now, we have two factors to consider:

(x³ - 3x²)^(-1/2) = 0, which means the expression inside the parentheses is equal to 0. However, this does not yield a real solution.

(3x² - 6x) = 0, which means the quadratic term equals 0.

Solving this quadratic equation:

3x² - 6x = 0

3x(x - 2) = 0

This equation has two solutions: x = 0 and x = 2.

Therefore,

At x = 0 and x = 2, the curve defined by y² = x³ - 3x² has a horizontal tangent.

Learn more about derivatives here:

https://brainly.com/question/29020856

#SPJ4

The graph shows the density of a substance. Find the density in grams per milliliter.

Answers

Answer:

2 grams per millimeter

Step-by-step explanation:

the point (2,1) shows us this.

queuing system a has a utilization of 80 percent, and queuing system b has a utilization of 90 percent. both have a single server. say the utilization of both systems increases by 5 percent; that is, a increases from 80 percent to 85 percent while b increases from 90 percent to 95 percent. which system is likely to experience the bigger change in the average time in queue?

Answers

For queuing system B, the average time in queue ids going to change significantly as a result of increased utilization.

This is because queuing system B is initially heavily loaded and has less capacity to handle more requests. As a result, an increase in utilization can cause a significant increase in average queue latency on system B compared to system A.

Average Queue Time is a measure of the time a customer or request spends being processed by a server. It is affected by several factors such as server load, customer or request arrival rate, and server service rate. As the load on the queuing system increases, it means that the server is being used more frequently and is no longer available to process incoming requests. This will increase the average time in the queue as more requests accumulate and have to wait to be processed. The greater the increase in occupancy, the greater the impact on average latency.

Read more about Latency on brainly.com/question/29725758

#SPJ4

two circles have the same center $c.$ (circles which have the same center are called concentric.) the larger circle has radius $10$ and the smaller circle has radius $6.$ determine the area of the ring between these two circles.

Answers

The area of the ring between these two circles if the radius of the larger and the smaller circle is 10 and 6 is 200.96.

Given:

two circles have the same center $c.$

the larger circle has radius $10$

and the smaller circle has radius $6.$

we are asked to determine the  the area of the ring between these two circles.

⇒ Area of the ring =  Area of larger circle - area of smaller circle

Area of circle = πr²

⇒ Area of larger circle  = π(10)²

= 100π

⇒ Area of small circle = π(6)²

= 36π

Area of the ring =  Area of larger circle - area of smaller circle

Area of the ring = 100π - 36π

= 64π

= 200.96

Hence the area of the ring is 200.96

Learn more about Circles here:

brainly.com/question/25871159

#SPJ4

a study was conducted in which two types of engines, a and b, were compared. gas mileage, in miles per gallon, was measured. 50 experiments were conducted using engine type a and 75 experiments were done with engine type b. the gasoline used and other conditions were held constant. the average gas mileage was 36 miles per gallon for engine a and 42 miles per gallon for engine b. assume that the population standard deviations are 6 and 8 for engines a and b, respectively. we found a 95% confidence interval on the difference of population mean gas mileages for engines a and b is (-8.46,-3.54). how do you interpret this interval?

Answers

The Central Limit Theorem establishes that the sampling distribution of the sample means of size n can be approximated to a normal distribution with mean and standard deviation s = /n for a normally distributed random variable X, with mean and standard deviation.

The Central Limit Theorem can also be used with skewed variables if n is at least 30.

The sampling distribution of the sample percentage for a proportion p in a sample of size n will be about normal, with mean and standard deviation s = p(1-p)/n.

Between-normal-variables subtraction

The mean is the difference between the means when two normal variables are subtracted, and the standard deviation is the square root of the sum of the variances.

Calculation:

Average gas mileage (A): Mean 36, SD 6, sample size 50:

So, μA = 36, sA = 6/√50 = 0.8485

Gas mileage B: Mean 42, SD 8, and sample size of 50:

So, μB = 42, sB = 8/√50 = 1.1314

Arrangement of the difference:

Mean: 36 - 42 = -6 where A - B

Standard deviation: 1.4142

Locate the point estimate.

This is the mean difference, which is -6 mpg.

B. Determine the error margin.

To determine our level, we must deduct 1 from the confidence interval and divide the result by two. So: 1 - 0.95/2 = 0.025

Now that z has a pvalue of, we must locate it in the Ztable.

Z = 1.96 since it has a pvalue of.

Identify the margin of error M as follows.

M = zs = 1.96 * 1.4142 = 2.77

2.77 mpg is the error margin.

C. Create the 95% confidence interval for the variance in population mean fuel economy between engines A and B, then analyze the findings (5 pts)

The sample mean plus M determines the interval's upper end. Therefore, it is -6 + 2.77 = -3.23 mpg.

The difference between the population mean gas mileage for engines A and B and how to interpret the data, in mpg, have a 95% confidence interval of (-8.77, -3.23) means, whereas the standard deviation is the sum of the variances' square roots.

Average gas mileage (A): Mean 36, SD 6, sample size 50:

So, μA = 36, sA = 6/√50 = 0.8485

Gas mileage B: Mean 42, SD 8, and sample size of 50:

So, μB = 42, sB = 8/√50 = 1.1314

Arrangement of the difference:

Mean: 36 - 42 = -6 where A - B

Standard deviation: 1.4142

Locate the point estimate.

This is the mean difference, which is -6 mpg.

B. Determine the error margin.

By subtracting 1 from the confidence interval and dividing the result by 2, we can determine our level. So: 1 - 0.95/2 = 0.025

We must now locate z in the Ztable because it has a pvalue of

Z = 1.96 since that has a p value of.

Find the margin of error now. such that M

M = zs = 1.96 * 1.4142 = 2.77

The error margin is 2.77 mpg.

C. Build the 95% confidence interval for the difference between the population-mean fuel economy for engines A and B, then analyze the findings (5 pts)

The sample mean multiplied by M determines the interval's upper end. Consequently, it is -6 + 2.77 = -3.23 mpg.

The 95% confidence interval for the difference between population mean gas mileage for engines A and B and how to interpret the data, in mpg, is (-8.77, -3.23).

When should you calculate the population standard deviation?

You should calculate the population standard deviation when the dataset you’re working with represents an entire population, i.e. every value that you’re interested in. The formula to calculate a population standard deviation, denoted as σ.

What is the percent confidence interval for the population mean?

A % confidence interval (CI) for the population mean is given by Example 6.2 A meat inspector has randomly measured 30 packs of acclaimed 95% lean beef. The sample resulted in the mean 96.2% with the sample standard deviation of 0.8%.

To know more about Interval visit:-

brainly.com/question/13708942

#SPJ4

m×n , when m=13 and n=12

Answers

Answer:

156

Step-by-step explanation:

mxn

13x12= 156

......

A weather forecaster says that the temperature is changing at a rate of -8° per hour. At this rate, how long will it take for the temperature change to be -24°? It will take _____ hours for the change in temperature to be -24

Answers

The transition to -24 degrees will take three hours .The balance between energy coming into and going out of the planet's system determines its temperature.

What influences how the temperature fluctuates?The balance between energy coming into and going out of the planet's system determines its temperature. The Earth warms up when incoming solar energy is absorbed by the Earth system. Earth does not warm as a result of solar energy being reflected back into space. Earth cools as energy that has been absorbed is ejected back into space.Since 1880, the Earth's average temperature has increased by 0.14° F (0.08° C) every decade; however, since 1981, the pace of warming has increased by 0.32° F (0.18° C) per decade, or more than twice as fast. Using NOAA's temperature data, 2021 ranked as the sixth-warmest year ever.          

Explanation:

-8% / -24 = 3.

The transition to -24 degrees will take three hours.

To learn more about Temperature refer to:

https://brainly.com/question/25677592

#SPJ1

How do you simplify (2−i) / (5+i) ?

Answers

To simplify [tex]\frac{2-i}{5+i} = \frac{9}{26} -\frac{7}{26} i[/tex] , multiply the numerator and denominator by the conjugate of the denominator.

A complex number's conjugate A+bi equals a-bi. A real number is the result of a complex number and its conjugate. That fact will be used here.

[tex]\frac{2-i}{5+i} =\frac{2-i}{5+i} . \frac{5-i}{5-i}[/tex]

[tex]= \frac{(2-i)(5-i)}{(5+i)(5-i)}[/tex]

[tex]=\frac{10-2i-5i-1}{25-5i+5i+1}[/tex]

[tex]=\frac{9-7i}{26}[/tex]

[tex]=\frac{9}{26}-\frac{7}{26}i[/tex]

To learn more about a real number, refer:-

https://brainly.com/question/551408

#SPJ4

What is the additive inverse of the polynomial -6x^3 +4x^2 -4

Answers

6x³ -4x² +4 is the additive inverse of polynomial -6x³ +4x² -4

What is Polynomial?

Polynomial is an expression consisting of indeterminates and coefficients, that involves only the operations of addition, subtraction, multiplication, and positive-integer powers of variables

The given polynomial is  -6x³ +4x² -4

Polynomial is minus six x cube plus four x square minus four.

Additive inverse simply means changing the sign of the number and adding it to the original number to get an answer equal to 0.

6x³ -4x² +4 is the additive inverse of -6x³ +4x² -4

because -6x³ +4x² -4+6x³ -4x² +4=0

Hence, 6x³ -4x² +4 is the additive inverse of polynomial -6x³ +4x² -4

To learn more on Polynomials click:

https://brainly.com/question/11536910

#SPJ1

SHOW WORK FOR BRAINLIST DUE TODAY

Answers

The graph of Stewart's assignment added as an attachment

How to draw the graph of the scenario?

From the question, we have the following parameters that can be used in our computation:

Number of assignments = 36

Rate of assignment per day = 4

This means that the equation of the scenario is

Number of assignments remaining = Initial number of assignments - Rate of assignment per day * Number of days

Represent the number of assignments remaining with y and the number of days with x

So, we have the following representation

y = Initial number of assignments - Rate of assignment per day * x

Substitute the known values in the above equation, so, we have the following representation

y = 36 - 4 * x

Evaluate the products

y = 36 - 4x

So, the equation is y = 36 - 4x and the graph is added as an attachment

Read more about linear graphs at

https://brainly.com/question/4025726

#SPJ1

1/8 of a number is 56. What is the number?

Answers

1/8 of a number is 56. The number is equal to 448.

let the number=x

1/8 of a number means we have to multiply 1/8 with x.

1/8 of a number =1/8x

now according to the condition, 1/8 of a number is 56 which means that we have 1/8x equal to 56.

1/8x=56

which gives us a simple algebraic equation in a single variable x. we can solve it accordingly .i,e multiplied 8 on both sides of the equation gives

x=56*8

x=448.

to learn more about algebraic expression based on conditions click on brainly.com/question/9547354

#SPJ4

Other Questions
If the solar calendar was so important to Olmec farmers for growing crops, where was the calendar kept?A) each farmer had a calendarB) priests kept the calendar hiddenC) each center had stelae with calendars carved on themD) traders carried the calendar with them Drag the tiles to the correct boxes to complete the pairs.Drag the tiles to the correct boxes to complete the pairs.Match the descriptions to the processes.Ice cream starts dripping down the sides of an ice cream cone.Fog is created by using dry ice.Frost forms on trees on a very cold day.The mirror gets fogged up when you breathe on it.Your wet hair dries after a few minutes.Liquid glass cools and hardens. A piano tuner stretches a steel piano wire with a tension of 1070N . The wire is 0.400m long and has a mass of 4.00g .A) What is the frequency of its fundamental mode of vibration?B) What is the number of the highest harmonic that could be heard by a person who is capable of hearing frequencies up to 1.00 art has come out with a new and improved product. as a result, the firm projects an roe of 25%, and it will maintain a plowback ratio of 0.20. its earnings this coming year will be $3 per share. investors expect a 12% rate of return on the stock. what is the present value of growth opportunities for art? 16 The management of Omega Manufacturing Is implementing o plan to minimize production mistakes by allowing teams that work in each area ortho production facility to develop a plan and then monitor their area to ensure the reduction of errors. The managers are engaging in 5 points Multiple Choice Stop the minimal defect approach Innovative planning quality control efficiency monitoring the internal rate of return is a measure of: multiple choice the rate actually earned by the project, considering the time value of money. the rate actually earned by the project, based on accounting income. the rate used to discount the future cash flows to reflect the time value of money. the firm's cost of capital. How do you teach regrouping to 2nd graders? ______________________ theory of personality focuses on what is observable and measurable and not on the unconscious mind. how does interviewing a healthy patient differ from a patient with a known health condition a monochromatic light beam is incident on a barium target that has a work function of 2.50 ev. if a potential difference of 1.00 v is required to turn back all the ejected electrons, what is the wavelength of the light beam? 355 nm 497 nm 744 nm 1.42 pm none of those answers at the end of glycolysis, in what molecule(s) can one find the energy that was contained in the chemical bonds of glucose? select all that apply. read each statement and determine if it is true or false. a. a monopolistic competitor, much like a firm in perfect competition, sells its product at a point where the price is equal to the marginal cost. true false b. advertising can play a role as an indirect signal of product quality to customers. true false c. monopolistically competitive industries are more likely to make use of advertising to create products that catch on in mainstream popularity than industries in perfect competition. true false d. in the long run, monopolistic competitors make a similar amount of profit to monopolists, since, in both cases, the firm's demand curves are downward sloping, and at the profit maximizing point, the marginal cost is equal to the marginal revenue. true false e. in the short term, a monopolistic competitor will make a profit if the demand curve is above the average total cost curve at some point. true false According to Partial Replacement Models,modern humans first appeared in AfricaA. and India, simultaneouslyB. about 500,000 years agoC. and remained there until modern humans from Asia displaced themD.and interbred with premodern populations of Eurasia, thus partially displacing themE.but were later displaced by European Neandertals which of the following is not one of the credit categories for points in leed certification? energy and atmosphere why was it important for citizens to participate in the assembly; what role did cleisthenes play in the development of greek democracy?; how did the peloponnesian war impact athens?; what advantage did the greek army have at the battle of marathon?; what advantage did athens have during the peloponnesian war?; the world's first democracy developed in the greek city-state of; what is a characteristic of an oligarchy?; how did the persian wars affect the greek army? Dams provide water for 40% of irrigated land, yet there are disadvantages to dams. Which of the following is NOT a disadvantage of dam use?a) loss of water due to evaporationb) provide electricity for many countriesc) increase in salinity due to evaporation and runoffd) increase in sediment buildup leads to less available watere) depletion of river waterb) provide electricity for many countries in characterizing an air mass, which of the following statements is not true?: An air mass initially reflects the characteristics of its source region.Air masses interact to create weather patterns.They are relatively homogeneous in terms of temperature and humidity.Air masses most often originate in the midlatitudes.Front form where unlike air masses meet. one obstacle soraab faces when problem solving involves getting hung up on an incorrect view of a problem. this is an example of evaluate performance characteristics of two string matching algorithms (brutal force algorithm and knuth-morris-pratt algorithm) for the following case: pattern: agtacg string: gcagtacgcagagagtatacagtacg compare performance of these two algorithms in terms of preprocessing time and matching time. Read the excerpt from Franklin Delano Roosevelt's speech, The Great Arsenal of Democracy, 1940.The Nazis have justified such actions by various pious frauds. One of these frauds is the claim that they areoccupying a nation for the purpose of "restoring order." Another is that they are occupying or controlling anation on the excuse that they are "protecting it" against the aggression of somebody else. For example,Germany has said at she was occupying Belgium to save the Belgians from the British. Would she thenhesitate to say to any South American country: "We are occupying you to protect you from aggression by theUnited States"? Belgium today is being used as an invasion base against Britain, now fighting for its life. Andany South American country, in Nazi hands, would always constitute a jumping off place for German attack onany one of the other republics of this hemisphere.Use context clues or a dictionary to select the best definition for use of frauds.a person who is a sham or a poseura forthright direct attackan instance of deception, trickery or deceitO a copy meant to look like the original