What is the substance that regulates life’s processes?

Answers

Answer 1

Answer:

Heyo!

Explanation:

At all levels of the organizational scheme, there is a division of labor. Each component has its own job to perform in cooperation with others. Even a single cell, if it loses its integrity or organization, will die.

Um Hope This Helps? ._.


Related Questions

Im crying because im so in a hurry help me fastas you can in this science question.

Answers

energy convention: Convection is the motion of a fluid driven by temperature differences across that fluid. When a fluid is heated, the region in closest contact with the heat source becomes less dense due to increased kinetic energy in the particles. Convection is one of the fundamental ways that heat is transferred

Which organelles are found in plant cells but not in animal cells?

Answers

Answer:

Organelles that are found in plant cells, and not in animal cells, are chloroplasts, a call wall, specialized plastids, and a large central vacuole.

Hope you found this helpful <3

Answer:

cell wall and chloroplast

Explanation: hope this helps:)

3. Write the complimentary sequence of DNA for the following strand:
5'-AATTAGGAGCCCAGCTTTGCCGA-3'

Answers

The correct answer is TTAATCCTCGGGTCGAAACGGCT

This is because whenever you’re trying to find the complementary sequence of DNA, you basically switch which the listed base and it’s correspondent.

Adenine -> Thymine
Cytosine -> Guanine

Hope this helps!! :)

Phosphorus is mainly stored in the

Answers

Answer:

Phosphorus is mainly stored in the  soil and rocks in the form of phosphate.

Explanation:

i hope this helps

organisms that have many characteristics in common are grouped into a _______?

Answers

Organisms that have many characteristics in common are grouped into a ’species’ - hope this helped :)

Answer:

The are grouped in species...

Commodity processors extract juice from oranges and
it in order to kill microbes and slow spoilage.

Answers

Answer:

Microbes

Explanation:

What kind of mineral ID is this?

please hurry !! thank you :)

Answers

Answer:

Cleavage and Fracture

Explanation:

Cleavage is the way a mineral breaks. Many minerals break along flat planes, or cleavages—some in only one direction (like mica), others in two directions (like feldspar), and some in three directions (like calcite) or more (like fluorite). Some minerals, like quartz, have no cleavage. Cleavage is a profound property that results from a mineral's molecular structure, and cleavage is present even when the mineral doesn't form good crystals. Cleavage can also be described as perfect, good or poor.

what is the role of rabbit in food chain ?​

Answers

Answer:

Rabbits are herbivores

Explanation:

Rabbit are herbivorous and directly depends on the green plants generally grasses for supply of food and energy. It is found at the second position in the foodchain. We can say that the rabbit is primary consumer in food chain. It is also link between the foodchain of grassland and forest.

Answer:

The controller that keeps plant life in check

Explanation:

A student wants to create a liquid volcano. The student observes bubbles in the soft drink prior to opening it. The student first proceeds to open the soft drink bottle and place it on the floor. Next the student drops candy tablets into the drink using a rolled piece of paper, so that the tablets are able to fall into the drink continuously. The student notices a very powerful reaction as the drink fizzes and starts to bubble. In this scenario, what would be the catalyst ?

Answers

Answer: the candy tablets being added to the drink

Explanation: i’m on the test right now and that’s what seems more logical

Answer:

A student wants to create a liquid volcano. The student observes bubbles in the soft drink prior to opening it. The student first proceeds to open the soft drink bottle and place it on the floor. Next the student drops candy tablets into the drink using a rolled piece of paper, so that the tablets are able to fall into the drink continuously. The student notices a very powerful reaction as the drink fizzes and starts to bubble. In this scenario, what would be the catalyst ?

A: The candy tablets being added to the drink

why did europeans want to conquer the new world ?

Answers

Answer:

Europeans wanted to explore the world so that they could gain wealth. European rulers fought many wars and they were very expensive so they needed to find gold, silver and precious stones to pay for them.

Explanation:

NEED HELP ASAP!!!!

In trying to prove continental drift, Alfred Wegener used evidence from long ago to show that in the distant past, similar animal species lived in places that are ______today. For example, fossils of the________ were found in India, Africa, and Antarctica.

Answers

Wegener used Gondwana glaciation evidence, lithological and structural evidence, plates fitting together, and paleontological evidence to prove his theory. 1) separated 2)  Lystrosaurus.

What evidence used Wegener to prove his theory?

Since Wegener’s theory about continental drift was seriously criticized, he used a list of 10 pieces of evidence proposed by the geologist Du Toit that supported his theory.

The list includes Gondwana glaciation evidence, lithological and structural evidence, plates fitting together, and paleontological evidence.

Among the paleontological evidence, plant and animal fossils from the same species were found in currently separated continents. This distribution suggests the existence of a big unique supercontinent where these species used to inhabit.

For instance,

Glossopteris (fern) impressions are widely distributed in determined areas of Africa, South America, India, and Australia.

Terrestrial vertebrate fossils also support the theory. The presence of Triassic tetrapods in all continents suggests terrestrial corridors between landmasses.

Lystrosaurus ⇒ Triassic reptile ⇒ Found in Africa, India, and Antarctica

⇒ Mesosaurus ⇒ Triassic reptile ⇒ Found in South America and Africa

⇒ Cygnonathus ⇒ Triassic reptile ⇒ Found in South America and Africa

Finding these fossils on current different continents suggests that these landmasses were once together, and these species used to live in the same region.

With time, continents diverged and got separated by the ocean. The region where these species used to live got divided and fossils got separated.

In trying to prove continental drift, Alfred Wegener used evidence from long ago to show that in the distant past, similar animal species lived in places that are _separated_today. For example, fossils of the_Lystrosaurus_ were found in India, Africa, and Antarctica.

1) Separated

2) Lystrosaurus

You can learn more about Wegener evidences at

https://brainly.com/question/839947

https://brainly.com/question/9444622

#SPJ1

I will give brainliest!!!

You're looking through a microscope at a eukaryotic cell and notice that its genetic material (DNA) is openly floating around the cytosol.

What could be a possible cause for what you're seeing through the microscope?

Choose 1 answer:

(Choice A)
A
The lysosome is damaged.

(Choice B)
B
The nucleus is damaged.

(Choice C)
C
The vacuole is damaged.

(Choice D)
D
There is no cause; genetic material should be floating around the cell in this manner.

Answers

Answer:

B. The nucleus is damaged.

Explanation:

Eukaryotic cells contain a membrane-bound nucleus and numerous membrane-enclosed organelles. DNA is present in the nucleus of the cell. If the nuclear membrane is ruptured/damaged then the nucleoplasm along with the DNA will openly float around the cytosol.

Answer: The nucleus is damaged.

Explanation: The nucleus is supposed to keep genetic material (DNA) housed within its membrane-bound structure, but in this cell, the genetic material is openly floating around the cell's cytosol. Have a nice day :)

Why is it beneficial for the earth to have both autotrophic and hypertrophic?

Answers

Because it will create balance on the earth. For example if there are only autotrophs there will be competition for nutritious and space for the roots to grow .Also for the heterotrophs, the harbivous will be hard for them to find plants to eats eventually it will lead to starvation then death and their death will affect carnivores because the organisms that they used to hunt are all dead now. So when there is a balance between autotrophs and heterotrophs they will help each other to survive.

Which of the following is a function of proteins? (AKS 1a)
O A.
A. long term energy storage
O
B. help with slowing down chemical reactions
O
C. build tissues such as bone and muscle
O
D. raise activation energy and lower reaction rate

Answers

Answer:

ans is A long term energy

storage

Long term energy storage

Plz help I will mark you brainlist plz ​

Answers

Answer:

ISOTOPES

the same number of protons

but difference numbers of neutrons

IONS

because they have lost or gained one or more electrons

Answer:

atoms of the same element have same proton number but different nucleon number I hope this help u if u want more ask me

This is a timeline depicting the development of atomic ___________. What word should be used to fill in the blank? Support your choice with evidence. A) Law. At each interval on the timeline, scientists described the patterns they saw in both atomic and subatomic structure. Eliminate B) Law. Scientists used observation, experimentation, and mathematical models to explain atomic stricter and the behavior of subatomic particles. C) Hypothesis. Scientists conducted experiments at each interval. They made educated guesses regarding atomic structure and then experimented to support or rejected the hypotheses. D) Theory. At each interval on the timeline, scientists made observations and conducted experiments to explain how atoms and/or subatomic particles behaved in order to determine atomic structure.

Answers

Answer:

Subatomic particle, also called elementary particle, any of various self-contained units of matter or energy that are the fundamental constituents of all matter. Subatomic particles include electrons, the negatively charged, almost massless particles that nevertheless account for most of the size of the atom, and they include the heavier building blocks of the small but very dense nucleus of the atom, the positively charged protons and the electrically neutral neutrons. But these basic atomic components are by no means the only known subatomic particles. Protons and neutrons, for instance, are themselves made up of elementary particles called quarks, and the electron is only one member of a class of elementary

Explanation:

because it is

it's d lol

Theory. At each interval on the timeline, scientists made observations and conducted experiments to explain how atoms and/or subatomic particles behaved in order to determine atomic structure. Let's take one example: Rutherford's gold foil experiment. Based on observing the behavior of alpha particles directed at a gold foil screen, Rutherford determined that an atom consisted of mostly empty space, with all of its positive charge concentrated in its center in a very tiny volume, surrounded by a cloud of electrons. Yet, further experimentation eventually lead to another model and another theory of atomic structure.

Which of the following could be a sequence in the carbon cycle?

Answers

Answer:

plants take in carbon dioxide and produce glucose --> animals consume plants --> animals break down glucose and release carbon dioxide

Explanation:

The carbon cycle is the sequence through which carbon is cycled through ecosystems. The carbon cycle usually occurs in the following order:

First, plants take in carbon dioxide and convert it to glucose.

Then, animals consume plants and break down glucose through the process of respiration.

Finally, this process releases carbon dioxide back into the atmosphere, and the cycle continues.

Charles Hillman, an associate professor at the University of Illinois, is conducting research into why children are better at problem-solving after exercise. He places 20 kids, approximately 10 years of age, on a treadmill for 20 minutes. Another group of 10-year-old kids sits in a chair for 20 minutes. Dr. Hillman then measures the brain wave activity of both groups. The group who exercised showed a 5% increase in the P3 waves, which occur during decision- making. What would need to be done in order to make this experimental outcome accepted in the scientific community? Group of answer choices More time would need to be allowed for the experiment. Other scientists would need to confirm the results by performing the same experiment. The same test would have to be done using a different type of exercise. Girls and boys would need to be tested separately and then together.

Answers

Answer:

Other scientists would need to confirm the results by performing the same experiment.

Explanation:

According to this question, an experiment was conducted by an associate professor, using 20kids, to discover why children are better at problem-solving after exercise. He arrived at a result that Children who exercised showed a 5% increase in the P3 waves, which occur during decision- making.

However, in order for this findings by Charles Hillman to be generally accepted and recognized in the scientific community, which is a connection of several scientists, the results need to be confirmed by performing the same tests or experiment.

Note that, an experiment becomes a scientific theory if it has undergone series of repeatable tests. One of the key features of scientific experiment is that it must be repeatable.

1. What makes water so unique?

Answers

Answer:

It is the reason the sky is blue

Explanation:

water helps you live, literally.

Describe a non-biological hierarchy that exists in everyday life and how it relates to a biological system.


Answers

Answer:

A non-biological hierarchy could be the way the military is organized, with the soldiers at the very bottom and the big commanders on top. (I don't know the specific names for each of them) This relates to a biological heirarchy since the smaller, sadly less important things are at the bottom, like atoms and soldiers, and each group of soldiers makes a regiment (which would be a molecule), then a battalion (which would be a cell), then so on. (I dont know the order of the groups but you can look it up)

Are fungi Producers or Consumers?

Answers

Answer:

Bacteria and fungi are actually decomposers. They eat decaying matter - dead plants and animals and in the process they break them down and decompose them.

Fungi it’s a decomposer because it decomposes the bodies of dead plants and animals.

Who was the first person to see cells under the microscope and give them name a Robert Hooke b Theodor Schwann c Anton van Leeuwenhoek d Matthias Schleiden

Answers

Answer:

a) Robert Hooke

Explanation:

The cell was first discovered by Robert Hooke in 1665, which can be found to be described in his book Micrographia. In this book, he gave 60 'observations' in detail of various objects under a coarse, compound microscope.

The first person to observe the cell under the microscope is Robert Hooke, who is present in Option a. Robert Hooke is the person who first observed cork cells under the microscope and gave them a name. Option a is correct

What is a cell?

In the early stages of the earth, cells were not as developed as those of today's eukaryotes; they had RNA as genetic material, and later by evolution, today's eukaryotic cells developed. Those RNA-containing cells were extremely susceptible to mutation, whereas today's DNA-containing cells are not.

The eukaryotic cell contains numerous organelles that perform various functions, such as the lysosome, which degrades pathogens, the chloroplast of plants, which perform photosynthetic reactions, the nucleus of eukaryotic cells, which conserves DNA, and the mitochondria, which generate energy through cellular activities.

Hence, the first person to observe the cell under the microscope is Robert Hooke and gave them a name, who is present in Option a.

Learn more about the cell here.

https://brainly.com/question/12129097

#SPJ5

​Which of the following structures are found in eukaryotes, but not prokaryotes?

Choose 1 answer:

(Choice A) Golgi body

(Choice B) Cytosol

(Choice C) Cilia

(Choice D) Cell membrane

Answers

i’m pretty sure the answer is A

The structures that are found in eukaryotes, but not prokaryotes are:

Golgi bodyCilia. Both prokaryotic and eukaryotic cells contain cytosol and cell membrane structures.

The Golgi apparatus is known as a cellular organelle whose function is to handle the proteins synthesized by the endoplasmic reticulum.

It is found in eukaryotic cells and is responsible for completing the production process of certain proteins.

Cilia are a series of short and numerous mobile extensions of the plasma membrane that line the cell surface of some eukaryotic cells.

Prokaryotic cells form living unicellular organisms, they present their genetic material dispersed in the cytoplasm, because they lack a cell nucleus.

Its cell membrane is responsible for delimiting the organism, which also lacks any type of organelle or cell divisions.

Therefore, we can conclude that the structures that are found in eukaryotes, but not prokaryotes are: Golgi body and Cilia and both prokaryotic and eukaryotic cells contain cytosol and cell membrane structures ..

Learn more here: https://brainly.com/question/776836

If a squirrel climbs a tree at 16m/s how many meters will it travel every hour ? ____ m/hr

Answers

Answer:

57600

Explanation:

16x60x60

Brainiest please :D

The distance travelled per hour by the squirrel as it climbs a tree at 16m/s is :  57600m/hr

Determine the distance travelled every hour

Given data :

velocity = 16m/s

To determine the distance travelled per hour

16 m * 60secs * 60 minutes

= 16 * 60 * 60

= 57600 m

Hence we can conclude that the The distance travelled per hour by the squirrel as it climbs a tree at 16m/s is :  57600m

Learn more about Velocity : https://brainly.com/question/4931057

#SPJ2

Plsss helppp plllsss helppp

Answers

Answer:

A

Explanation:

A solution with a pH lower that 7.0 is acidic, so that narrows the answers down to a and d. OH- is a base and H+ is acidic, so the answer is A

Answer:

I cant really read it, its kinda blurry.

Explanation:

Rice, wheat, soybeans, and _______ are considered the four angiosperms that are responsible for early agriculture.

Answers

Answer:

Corn

Explanation:

I'm not 100% sure so lmk ig I'm right or wrong

Answer:corn

Ethylene

dormant

anther

stigma

fruit

temperature

Wind pollination required a great deal of excess pollen, just so some of it lands, by chance, in the right place. Animal pollination is more selective because animals pick pollen up and carry it directly to where it needs to be. Although there is still a chance that the pollen will be from the wrong plant species, plants can manipulate variations in animal behavior through the structures of their flowers, the time and season of flowering, or the rewards or attractive chemicals they produce to narrow the field of pollinators, and increase the chances of having exactly the right pollen put in exactly the right place.

Explanation:

Accuracy is a measure of how close a value is to its true value. You can control accuracy by choosing the appropriate tool or instrument and using it carefully. How could the students in the following questions improve their accuracy? Tyrrell wanted to measure the growth of tomato plants in response to different types of fertilizer. Which tool would be most accurate?

Answers

Answer:Metric ruler

Explanation:

Answer:

1. Metric ruler

2. a pH meter can distinguish smaller differences in pH as compared to a pH strip.

Explanation:

Got those right on edge ;)

I will give brainliest!!!!!!!
Protein synthesis can occur on the rough endoplasmic reticulum (ER) but not on the smooth ER.

Which cell structures are attached to the surface of the rough ER that allow it to make proteins?

Choose 1 answer:

A
DNA strands

(Choice B)
B
Vacuoles

(Choice C)
C
Chloroplasts
(Choice D)
D
Ribosomes

Answers

Answer:

The answer is b

What does a targeted digestive capsule mean?

Answers

Targeted to help just that the (digestive system) a digestive capsule is a coated tablet that is digested

SCIENCE- help me please I have to turn this in tonight PLEASE.............

Answers

Answer:

Yes,if it has a large mass it will have a large weight Awnser (2)

Other Questions
The______of the rectangular prism is 52 square units because LaTeX: 8+8+6+6+12+12=528+8+6+6+12+12=528+8+6+6+12+12=52. Find the missing side length.Im new to the app and just trying to figure out how thinks work :) sorry An electron has a mass NEED HELP!!! WILL MARK BRAINLIEST!!! The sum of b and 9 is 12 less than 20A. 12-20=9-bB. b+9=20-12C. 9b=12-20D. 9-b=20-12 All audiences are _____________ and _____________.a.unique; diverseb.considerate; attentivec.individuals; culturald.groups; subgroups a chemical reaction a temperature change may occur because of the breaking or formation of chemical bonds that release excess energy. Since there is a change in temperature why wouldn't this reaction be considered a physical change instead of a chemical change ? Factors like length and intensity of light help plants to regulate daily rhythms such as flower opening and closing as well as seasonal rhythms like fruiting and seed formation. this is an example of... a) how abiotic factors affect organisms b) how biotic factors affect organisms c) how echolocation can be used by organisms d) how speciation affects organisms e) how geographical isolation affects organisms (2x+5)* (8x+5)* Help help help 4. Six workers are hired to weed a field byhand. Each is given a plot which is 9x11feet in size. What is the total area of thefield? EASY MATH QUESTION! WILL GIVE BRAINLIEST! (MUST EXPLAIN HOW YOU GOT YOUR ANSWER!) By the end of the first quarter of a football game, Gary had gained 42 yards and had lost 9 yards. Gary lost an additional 18 yards and gained 58 yards in the second quarter. Write an equation to represent his total yardage for the first half of the game. When the market rate is 8%, a company issues $50,000 of 9%, 10-year bonds dated January 1, 2017, that mature on December 31, 2026, and pay interest semiannually for a selling price of $60,000. When the bonds mature, the issuer records its payment of principal with a (debit/credit) What is the best way to begin a research project? Gather sources on your topic. Understand your research question. Evaluate sources on your topic. Write about your topic. Which of the following is not an example of evolution that has resulted from human activity? A. Many strains of bacteria are now resistant to some commonly used antibiotics. B. Some insect species are now resistant to pesticides. C. Because of hunting, species such as bears and wolves are in danger of extinction. D. Like certain other crops, domesticated strawberries are larger than wild strawberries. What is the definition of creative command 2 is a solution for True or False What was the importance of the formation of the Virginia House of Burgesses in 1619?aIt was the first elected assembly in the American colonies and reflected representative government bIt controlled all aspects of colonial government without any royal supervisioncIt established the principle that authority flows from the British monarch to the colonistsdIt created three equal branches of government, with checks on one another A computer professional who designs ways to organize, store, and retrieve data is a database ____. how can chimpanzees have different traits from one another What happened to the American Indians who fought in the French andThose who allied with Britain gained land and power.All American Indian groups gained land and power.Those who allied with France gained land and power.All American Indian groups lost land and power.