What other biome is it close to or in relation to desert ?

What Other Biome Is It Close To Or In Relation To Desert ?

Answers

Answer 1
i believe it’s cold deserts

Related Questions

I will give brainliest!!!!!!!
Protein synthesis can occur on the rough endoplasmic reticulum (ER) but not on the smooth ER.

Which cell structures are attached to the surface of the rough ER that allow it to make proteins?

Choose 1 answer:

A
DNA strands

(Choice B)
B
Vacuoles

(Choice C)
C
Chloroplasts
(Choice D)
D
Ribosomes

Answers

Answer:

The answer is b

A student wants to create a liquid volcano. The student observes bubbles in the soft drink prior to opening it. The student first proceeds to open the soft drink bottle and place it on the floor. Next the student drops candy tablets into the drink using a rolled piece of paper, so that the tablets are able to fall into the drink continuously. The student notices a very powerful reaction as the drink fizzes and starts to bubble. In this scenario, what would be the catalyst ?

Answers

Answer: the candy tablets being added to the drink

Explanation: i’m on the test right now and that’s what seems more logical

Answer:

A student wants to create a liquid volcano. The student observes bubbles in the soft drink prior to opening it. The student first proceeds to open the soft drink bottle and place it on the floor. Next the student drops candy tablets into the drink using a rolled piece of paper, so that the tablets are able to fall into the drink continuously. The student notices a very powerful reaction as the drink fizzes and starts to bubble. In this scenario, what would be the catalyst ?

A: The candy tablets being added to the drink

What do paleontologists do when they uncover incomplete fossils

Answers

Answer:

Explanation:

Paleontologists are scientists that study the history/existence of past lives by collecting and examining fossils. They use these fossils to determine the history and age an organism has existed. Fossils are remains of dead organisms (plants and animals) which serve as evidence of past lives that have existed on earth in the past. They could include bone remains or footprint of this animals.

Fossils (from bones) are however mostly incomplete because they decompose before they are "stored naturally" by sediments which covers them. When scientists discover this incomplete fossils, they are compared (if there has been similar fossils discovered before then) and are stored and transferred to the lab for examination. This examination includes anatomical comparison (to determine relatedness with other fossils/organisms), carbon dating (to determine age) and data comparison (which includes location and type of soil and habitat).

This is a timeline depicting the development of atomic ___________. What word should be used to fill in the blank? Support your choice with evidence. A) Law. At each interval on the timeline, scientists described the patterns they saw in both atomic and subatomic structure. Eliminate B) Law. Scientists used observation, experimentation, and mathematical models to explain atomic stricter and the behavior of subatomic particles. C) Hypothesis. Scientists conducted experiments at each interval. They made educated guesses regarding atomic structure and then experimented to support or rejected the hypotheses. D) Theory. At each interval on the timeline, scientists made observations and conducted experiments to explain how atoms and/or subatomic particles behaved in order to determine atomic structure.

Answers

Answer:

Subatomic particle, also called elementary particle, any of various self-contained units of matter or energy that are the fundamental constituents of all matter. Subatomic particles include electrons, the negatively charged, almost massless particles that nevertheless account for most of the size of the atom, and they include the heavier building blocks of the small but very dense nucleus of the atom, the positively charged protons and the electrically neutral neutrons. But these basic atomic components are by no means the only known subatomic particles. Protons and neutrons, for instance, are themselves made up of elementary particles called quarks, and the electron is only one member of a class of elementary

Explanation:

because it is

it's d lol

Theory. At each interval on the timeline, scientists made observations and conducted experiments to explain how atoms and/or subatomic particles behaved in order to determine atomic structure. Let's take one example: Rutherford's gold foil experiment. Based on observing the behavior of alpha particles directed at a gold foil screen, Rutherford determined that an atom consisted of mostly empty space, with all of its positive charge concentrated in its center in a very tiny volume, surrounded by a cloud of electrons. Yet, further experimentation eventually lead to another model and another theory of atomic structure.

If one strand of the DNA reads:
ATCCGCAT
What will the complementary strand be?

Answers

Answer:

in rna the strand would be    UAGGCGUA

G goes with C and A goes with U ( unless there is a T within the strand already then its an A that airs up with it )

Explanation:

but if its in DNA the strand will be     TAGGCGTA

G goes with C        T goes with A

Answer:

TAGGCGTA

Explanation: A with T: the purine adenine (A) always pairs with. the pyrimidine thymine (T) C with G: the pyrimidine cytosine (C) always pairs with. the purine guanine (G)

Small-chain fatty acids can enter the bloodstream directly, but large-chain fatty acids must be packaged first before entering the . can be carbohydrate-, protein-, or fat-based. remove cholesterol from tissues and deliver it to the liver for use in bile or excretion. Linoleic acid and alpha-linolenic acid are considered , and must be obtained from the diet. is needed to help mix fats with watery fluids. Carriers that transport monoglycerides and fatty acids to intestinal cells are called . contains 6 to 8 fatty acids connected to sucrose, and cannot be broken down by digestive enzymes. A is a lipoprotein carrier that transports digested fat and other lipids through the lymph system.

Answers

Answer:

lymph

fat substitutes

high-density lipoproteins

essential fatty acids

emulsification (bile)

micelles

olestra

chylomicron

Explanation:

Short-chain fatty acids can be absorbed directly into the bloodstream by the intestine capillaries, while long-chain fatty acids are released into the tiny intestine. Fat substitutes are chemical compounds that have similar properties of fats and oils, with fewer calories than fat. High-density lipoproteins (HDL) are referred as "good" cholesterol because they transport cholesterol from other body parts back to the liver. The alpha-linolenic acid and linoleic acid correspond to omega-3 and omega-6 fatty acids, respectively, and they are essential fatty acids that need to be consumed in the human diet. Emulsification is a chemical process consisting of mixing two immiscible liquids to form a semistable mixture. Micelles are chemical structures formed by the agglomeration of mixed lipids and bile acids, which support the action of lipases for digesting lipids. Olestra is a fat substitute that can be used in low-calorie diets for weight control. Finally, chylomicrons are ultra low-density lipoproteins (ULDLs) composed of triglycerides, phospholipids, cholesterol and proteins. The ULDLs are produced by intestinal cells.

Why is it beneficial for the earth to have both autotrophic and hypertrophic?

Answers

Because it will create balance on the earth. For example if there are only autotrophs there will be competition for nutritious and space for the roots to grow .Also for the heterotrophs, the harbivous will be hard for them to find plants to eats eventually it will lead to starvation then death and their death will affect carnivores because the organisms that they used to hunt are all dead now. So when there is a balance between autotrophs and heterotrophs they will help each other to survive.

why did europeans want to conquer the new world ?

Answers

Answer:

Europeans wanted to explore the world so that they could gain wealth. European rulers fought many wars and they were very expensive so they needed to find gold, silver and precious stones to pay for them.

Explanation:

Are fungi Producers or Consumers?

Answers

Answer:

Bacteria and fungi are actually decomposers. They eat decaying matter - dead plants and animals and in the process they break them down and decompose them.

Fungi it’s a decomposer because it decomposes the bodies of dead plants and animals.

3. Write the complimentary sequence of DNA for the following strand:
5'-AATTAGGAGCCCAGCTTTGCCGA-3'

Answers

The correct answer is TTAATCCTCGGGTCGAAACGGCT

This is because whenever you’re trying to find the complementary sequence of DNA, you basically switch which the listed base and it’s correspondent.

Adenine -> Thymine
Cytosine -> Guanine

Hope this helps!! :)

Commodity processors extract juice from oranges and
it in order to kill microbes and slow spoilage.

Answers

Answer:

Microbes

Explanation:

Rice, wheat, soybeans, and _______ are considered the four angiosperms that are responsible for early agriculture.

Answers

Answer:

Corn

Explanation:

I'm not 100% sure so lmk ig I'm right or wrong

Answer:corn

Ethylene

dormant

anther

stigma

fruit

temperature

Wind pollination required a great deal of excess pollen, just so some of it lands, by chance, in the right place. Animal pollination is more selective because animals pick pollen up and carry it directly to where it needs to be. Although there is still a chance that the pollen will be from the wrong plant species, plants can manipulate variations in animal behavior through the structures of their flowers, the time and season of flowering, or the rewards or attractive chemicals they produce to narrow the field of pollinators, and increase the chances of having exactly the right pollen put in exactly the right place.

Explanation:

NEED HELP ASAP!!!!

In trying to prove continental drift, Alfred Wegener used evidence from long ago to show that in the distant past, similar animal species lived in places that are ______today. For example, fossils of the________ were found in India, Africa, and Antarctica.

Answers

Wegener used Gondwana glaciation evidence, lithological and structural evidence, plates fitting together, and paleontological evidence to prove his theory. 1) separated 2)  Lystrosaurus.

What evidence used Wegener to prove his theory?

Since Wegener’s theory about continental drift was seriously criticized, he used a list of 10 pieces of evidence proposed by the geologist Du Toit that supported his theory.

The list includes Gondwana glaciation evidence, lithological and structural evidence, plates fitting together, and paleontological evidence.

Among the paleontological evidence, plant and animal fossils from the same species were found in currently separated continents. This distribution suggests the existence of a big unique supercontinent where these species used to inhabit.

For instance,

Glossopteris (fern) impressions are widely distributed in determined areas of Africa, South America, India, and Australia.

Terrestrial vertebrate fossils also support the theory. The presence of Triassic tetrapods in all continents suggests terrestrial corridors between landmasses.

Lystrosaurus ⇒ Triassic reptile ⇒ Found in Africa, India, and Antarctica

⇒ Mesosaurus ⇒ Triassic reptile ⇒ Found in South America and Africa

⇒ Cygnonathus ⇒ Triassic reptile ⇒ Found in South America and Africa

Finding these fossils on current different continents suggests that these landmasses were once together, and these species used to live in the same region.

With time, continents diverged and got separated by the ocean. The region where these species used to live got divided and fossils got separated.

In trying to prove continental drift, Alfred Wegener used evidence from long ago to show that in the distant past, similar animal species lived in places that are _separated_today. For example, fossils of the_Lystrosaurus_ were found in India, Africa, and Antarctica.

1) Separated

2) Lystrosaurus

You can learn more about Wegener evidences at

https://brainly.com/question/839947

https://brainly.com/question/9444622

#SPJ1

what are some alternatives to plastic
What are some alternatives for plastic

Answers

Answer:

paper, like instead of plastic straws you could use paper ones instead

Explanation:

Glass

Reusable Shopping Bags

Plastic Additives

Milk Protein

Grape Waste

Liquid Wood

PCL Polyesters

PHA Polyesters

PLA Polyesters

Starch-based Polymers

Hope this helps!! <3

Charles Hillman, an associate professor at the University of Illinois, is conducting research into why children are better at problem-solving after exercise. He places 20 kids, approximately 10 years of age, on a treadmill for 20 minutes. Another group of 10-year-old kids sits in a chair for 20 minutes. Dr. Hillman then measures the brain wave activity of both groups. The group who exercised showed a 5% increase in the P3 waves, which occur during decision- making. What would need to be done in order to make this experimental outcome accepted in the scientific community? Group of answer choices More time would need to be allowed for the experiment. Other scientists would need to confirm the results by performing the same experiment. The same test would have to be done using a different type of exercise. Girls and boys would need to be tested separately and then together.

Answers

Answer:

Other scientists would need to confirm the results by performing the same experiment.

Explanation:

According to this question, an experiment was conducted by an associate professor, using 20kids, to discover why children are better at problem-solving after exercise. He arrived at a result that Children who exercised showed a 5% increase in the P3 waves, which occur during decision- making.

However, in order for this findings by Charles Hillman to be generally accepted and recognized in the scientific community, which is a connection of several scientists, the results need to be confirmed by performing the same tests or experiment.

Note that, an experiment becomes a scientific theory if it has undergone series of repeatable tests. One of the key features of scientific experiment is that it must be repeatable.

Climate is a global factor that produces

A. Earth’s unique ocean and atmosphere.
B. the shape and elevation of landmasses.
C. a wide range of environmental conditions that shape communities.
D. solar energy within the atmosphere.

Answers

Answer:

C. a wide range of enviromental conditions that shape communitites

Explanation:

Climate is a global factor that produces a wide range of environmental conditions that shape communities. Option C.

Climate as a global factor

Climate is a global factor that generates a wide range of environmental conditions, including temperature, precipitation patterns, humidity, wind patterns, and seasonal variations.

These environmental conditions play a crucial role in shaping the structure and dynamics of ecosystems and the distribution of organisms. Climate influences factors such as the types of vegetation, availability of water resources, and the adaptability and survival of various species.

It affects the composition and characteristics of communities and ecosystems, making it a key factor in ecological processes and biodiversity.

More on climate change can be found here: https://brainly.com/question/33588826

#SPJ6

Who was the first person to see cells under the microscope and give them name a Robert Hooke b Theodor Schwann c Anton van Leeuwenhoek d Matthias Schleiden

Answers

Answer:

a) Robert Hooke

Explanation:

The cell was first discovered by Robert Hooke in 1665, which can be found to be described in his book Micrographia. In this book, he gave 60 'observations' in detail of various objects under a coarse, compound microscope.

The first person to observe the cell under the microscope is Robert Hooke, who is present in Option a. Robert Hooke is the person who first observed cork cells under the microscope and gave them a name. Option a is correct

What is a cell?

In the early stages of the earth, cells were not as developed as those of today's eukaryotes; they had RNA as genetic material, and later by evolution, today's eukaryotic cells developed. Those RNA-containing cells were extremely susceptible to mutation, whereas today's DNA-containing cells are not.

The eukaryotic cell contains numerous organelles that perform various functions, such as the lysosome, which degrades pathogens, the chloroplast of plants, which perform photosynthetic reactions, the nucleus of eukaryotic cells, which conserves DNA, and the mitochondria, which generate energy through cellular activities.

Hence, the first person to observe the cell under the microscope is Robert Hooke and gave them a name, who is present in Option a.

Learn more about the cell here.

https://brainly.com/question/12129097

#SPJ5

Plz help I will mark you brainlist plz ​

Answers

Answer:

ISOTOPES

the same number of protons

but difference numbers of neutrons

IONS

because they have lost or gained one or more electrons

Answer:

atoms of the same element have same proton number but different nucleon number I hope this help u if u want more ask me

If a squirrel climbs a tree at 16m/s how many meters will it travel every hour ? ____ m/hr

Answers

Answer:

57600

Explanation:

16x60x60

Brainiest please :D

The distance travelled per hour by the squirrel as it climbs a tree at 16m/s is :  57600m/hr

Determine the distance travelled every hour

Given data :

velocity = 16m/s

To determine the distance travelled per hour

16 m * 60secs * 60 minutes

= 16 * 60 * 60

= 57600 m

Hence we can conclude that the The distance travelled per hour by the squirrel as it climbs a tree at 16m/s is :  57600m

Learn more about Velocity : https://brainly.com/question/4931057

#SPJ2

Which of the following could be a sequence in the carbon cycle?

Answers

Answer:

plants take in carbon dioxide and produce glucose --> animals consume plants --> animals break down glucose and release carbon dioxide

Explanation:

The carbon cycle is the sequence through which carbon is cycled through ecosystems. The carbon cycle usually occurs in the following order:

First, plants take in carbon dioxide and convert it to glucose.

Then, animals consume plants and break down glucose through the process of respiration.

Finally, this process releases carbon dioxide back into the atmosphere, and the cycle continues.

If a carbon atom is bonded to two hydrogen atoms and two carbon atoms, what type of bond must exist between the
carbon atoms?
O single
O double
O triple
O quadruple

Answers

the answer is A. single .

What kind of mineral ID is this?

please hurry !! thank you :)

Answers

Answer:

Cleavage and Fracture

Explanation:

Cleavage is the way a mineral breaks. Many minerals break along flat planes, or cleavages—some in only one direction (like mica), others in two directions (like feldspar), and some in three directions (like calcite) or more (like fluorite). Some minerals, like quartz, have no cleavage. Cleavage is a profound property that results from a mineral's molecular structure, and cleavage is present even when the mineral doesn't form good crystals. Cleavage can also be described as perfect, good or poor.

Phosphorus is mainly stored in the

Answers

Answer:

Phosphorus is mainly stored in the  soil and rocks in the form of phosphate.

Explanation:

i hope this helps

SCIENCE- help me please I have to turn this in tonight PLEASE.............

Answers

Answer:

Yes,if it has a large mass it will have a large weight Awnser (2)

Which of the following is a function of proteins? (AKS 1a)
O A.
A. long term energy storage
O
B. help with slowing down chemical reactions
O
C. build tissues such as bone and muscle
O
D. raise activation energy and lower reaction rate

Answers

Answer:

ans is A long term energy

storage

Long term energy storage

Describe a non-biological hierarchy that exists in everyday life and how it relates to a biological system.


Answers

Answer:

A non-biological hierarchy could be the way the military is organized, with the soldiers at the very bottom and the big commanders on top. (I don't know the specific names for each of them) This relates to a biological heirarchy since the smaller, sadly less important things are at the bottom, like atoms and soldiers, and each group of soldiers makes a regiment (which would be a molecule), then a battalion (which would be a cell), then so on. (I dont know the order of the groups but you can look it up)

Im crying because im so in a hurry help me fastas you can in this science question.

Answers

energy convention: Convection is the motion of a fluid driven by temperature differences across that fluid. When a fluid is heated, the region in closest contact with the heat source becomes less dense due to increased kinetic energy in the particles. Convection is one of the fundamental ways that heat is transferred

Which organelles are found in plant cells but not in animal cells?

Answers

Answer:

Organelles that are found in plant cells, and not in animal cells, are chloroplasts, a call wall, specialized plastids, and a large central vacuole.

Hope you found this helpful <3

Answer:

cell wall and chloroplast

Explanation: hope this helps:)

What are some human interactions that are harming both the carbon and nitrogen cycles?

Answers

pollution is one of the options

Plsss helps plss

Extra 20 points

Answers

A is the answer I’m sure because I just took the test
Other Questions
Do you know that honeybees play a very important role in protecting the environment? Collect information about it. Please help ASAP! Will give brainliest if correct! SOMEONE HELLP ITS DUE IN 8 MINUTES "Do people still live a nomadic, farming lifestyle? If so, give an example of a current day group of people who live their lives like this." BIG POINTS The __________ secrete(s) __________, which promotes Na+ and water retention.A. Adrenal medulla; epinephrineB. Pancreas; cortisolC. Kidneys; corticosteroneD. Adrenal cortex; aldosteroneE. Thyroid; calcitonin Huggies is a popular brand of diapers that offers a variety of sizes and styles to fit babies based on weight, gender, and activity, such as swim diapers. Huggies devotes significant resources to conduct market research to understand customer needs and to ensure that its diaper products meet the needs of the customer. Rather than make just one diaper formulation, the products are highly customized and appeal to each customer's unique situation. This highlights one of the key differences between sales-oriented firms and marketing-oriented firms, which is _______. Solve for y 46=2y Simplify your answer as much as possible... Lifelong learning _____. is only important for professionals with advanced degrees can be formal or informal includes formal classroom training only stops when your career is over Why are Mercury ,Venus ,Earth and Mars called the terrestrial planets? why do you think some people are successful and others are unsuccessful in life? Three major segments of the transportation industry are motor carriers such as YRC Worldwide, railroads such as Union Pacific, and transportation logistics services such as C.H. Robinson Worldwide, Inc. Recent financial statement information for these three companies follows (in thousands): YRC Union Pacific C.H. Robinson Sales $4,832,400 $21,813,000 $13,476,084 Average total assets 1,939,800 53,486,000 3,199,348 a. Determine the asset turnover for all three companies. Round to one decimal place. YRC Union Pacific C.H. Robinson Need some help on my homework asap The area of the star shaped surface of this block is 1.2m^2. The thickness of the block is 25cm. What is the volume of the block? Fill in the correct conjugation of the verb given in parenthesis: er ___ (fragen) What is the difference between Kinesiology and Anatomy? Ethical behavior is a subset of which skillset?professional skillstechnical skillsprofessional conductinterpersonal skills There were f frogs in a pond. 88 of the frogs hopped away. Write an expression that shows how many frogs are in the pond now. Explain the meaning of the coefficient of determination in this problem Group of answer choices 97.60% of the variation in receipt per theater can be explained by the variation in Twitter activity 98.79% of the variation in receipt per theater can be explained by the variation in Twitter activity 97.60% of the variation in Twitter activity per theater can be explained by the variation in receipts 0.9879% of the variation in receipt per theater can be explained by the variation in Twitter activity why did the most early state constitutions make the legislature supreme? Please do these no fake stuff please. Click in the paperclip to see problems. how does institution relate to a government (can you leave your sources here btw pls i need to look into this more but idk where)