What’s the tone throughout Eleven By Sandra Cisneros

A.Elated
B. Antagonistic
C. Hopeful
D. Despondent

Answers

Answer 1
Dddddddddddddddddddd
Answer 2
The answer is D Despondent hope this helps

Related Questions

When a participle joins up with complements and modifiers to work as an adjective, you have a(n) __________________ phrase.

Answers

When a verb joins up with enhances and modifiers to figure as an adjective, you've got a(n) verb phrase.

What does one mean by verb phrase?

A verb phrase could be a cluster of words that has a verb, a modifier, and one or a lot of function word or noun phrases.A participial phrase could be a cluster of words that has a verb similarly because:the modifier(s) and/or (pro)noun(s) or noun phrase(s) that function the direct object(s), indirect object(s), or complement(s) of the action or state expressed within the verb, such as:

Jack dotted to the watercourse, removing his coat.

learn more about participle phrase

https://brainly.com/question/1386276

#SPJ4

What comes once in a minute, twice in a moment, but never in a thousand years?

Answers

Answer:

Explanation:

The letter "M"

Minute

Moment

Zero times in a thousand years

Answer:

The letter M. It comes one time in a minute, twice in a moment, but never in a thousand years.

Explanation:

Hope it helps! =D

beowulf story

1. After reading the story of Beowulf, what would you say were
the qualities deeply esteemed by the people of those times?
Read the passage that shows those traits.
2. Would these qualities be equally esteemed in our times?
3. Beowulf was a good leader. What qualities would you expect
from a national leader?
4. What quality/qualities of Beowulf would be worthy of emula-
tion by ordinary citizens?

Answers

Beowulf, a hero of the Geats, involves the aid of Hrothgar, the king of the Danes, whose mead hall in Heorot has been below assault by using the monster Grendel. After Beowulf slays him, Grendel's mother assaults the hall and is then defeated. victorious, Beowulf is going domestic to Geatland and turns into the king of the Geats.

One of the vital topics of Beowulf, embodied by way of its name character, is loyalty. At each step of his career, loyalty is Beowulf's guiding virtue. Beowulf comes to the assistance of the Danes (Scyldings) for complicated motives.

Beowulf helps students hint at the evolution of the English language in addition to examining the norms and traditions of the Anglo-Saxons during the medieval duration. Beowulf offers a glimpse of Britain's records and the earliest styles of literature of humans of Britain.

Learn more about Beowulf  here:

https://brainly.com/question/1830314

#SPJ9

Frequently it is said that children should stay in their place Please scrutinize examine carefully verifically this statement and explain It's meaning . A childshould stay in a child's.

Answers

Answer:

The phrase 'children should stay in their places' refers to children acting like adults or doing actions that may not be for their age/ viewed as for their age.

Explanation:

the wifes story Who is the first character to "fear"the man?

Answers

In regards to the wife story, the first character to "fear" the man is the wife.

What is the Wife's Story about?

In the story, the wife was said to be very scared of her husband and this was at the first instance and even with that, the husband still went to attack .

The main character is the story is a man that is called Ethan, he was one who loved another person even when the fact remains that he is  already a married man.

He was one who had the intentions that are said to be understandable to some extent that he had never had any love  for his  wife, Zeena.

Therefore, In regards to the wife story, the first character to "fear" the man is the wife.

Learn more about the Wife's Story from

https://brainly.com/question/11486547
#SPJ1

Which evidence from the passage best supports the inference that Hrothgar is a generous king?

Answers

Answer:

we need the image

NEED HELP ASAP DUE TONIGHT IM VERY CONFUSED

Answers

2 - At the heart of “The Possibility of Evil” is the revelation that evil exists in our everyday lives, which often goes unnoticed by the person perpetrating it. Miss Strangeworth spends her days cataloging the flaws she perceives in her neighbors, only to spend her evenings criticizing them anonymously via letters.

3 - Miss Strangeworth, a character in the short story “The Possibility of Evil” by Shirley Jackson, who is a complex character that is fond of taking care of her roses and helping people in the town. Because Miss Strangeworth is a deceptive, narrow minded lady with a God complex, her style of help is very strange.

Couldn't see 4

Choose the number of the sentence that expresses the main idea of the selection

(1) Less than a hundred years ago, many people saw adolescence as a time of great instability and strong emotions. (2) For example, G. Stanley Hall, one of the first developmental psychologists, portrayed adolescence as a period of “storm and stress,” fraught with suffering, passion, and rebelliousness. (3) Recent research, however, suggests that the “storm and stress” view greatly exaggerates the experience of most teenagers. (4) The great majority of adolescents do not describe their lives as filled with turmoil and chaos. (5) Most adolescents manage to keep stress in check, experience very little disruption in their everyday lives, and generally develop more positively than is commonly believed. (6) For instance, a cross-cultural study that sampled adolescents from ten countries, including the United States, found that over 75 percent of them had healthy self-images, were generally happy, and valued the time they spent at school and work.

Answers

The number of the sentence that expresses the main idea of the selection is.(1) Less than a hundred years ago, many people saw adolescence as a time of great instability and strong emotions.

What was the information about?

Adolescence was viewed by many people less than a century ago as a period of significant instability and intense emotions. One of the earliest developmental psychologists, G. Stanley Hall, for instance, described adolescence as a time of "storm and stress," marked by pain, passion, and rebelliousness.

However, recent research indicates that the "storm and stress" concept dramatically exaggerates what the majority of teenagers actually go through. The vast majority of teenagers do not say that their lives are turbulent and chaotic. Contrary to popular belief, the majority of adolescents are able to manage their stress, encounter very few disruptions in their daily lives, and usually progress in more favorable ways.

In this case, the sentence that expresses the main idea of the selection is that less than a hundred years ago, many people saw adolescence as a time of great instability and strong emotions.

Learn more about adolescence on:

https://brainly.com/question/1956818

#SPJ1

Use context clues to define faux pas.
Wearing black and brown together is sometimes called a fashion faux pas because many people think that mixing
the two is a mistake. a They just don't go together.
What is the most likely definition of faux pas?
Which word in the sentence is a synonym for faux pas?

Answers

Using the context clues, the likely definition of faux pas is "error," and the word that is a synonym for faux pas in the sentence is "mistake," as seen below.

What are context clues?

The words or phrases in a sentence or paragraph that help us understand the meaning of another word or phrase in the same sentence or paragraph are called context clues. Examples of context clues are:

AntonymsSynonymsExamplesExplanationsDefinitions

When it comes to the sentence provided in the question, the unfamiliar word whose meaning we must determine through the use of context clues is "faux pas." The sentence is about the fact that mixing black and brown is not well seen in fashion, being considered a mistake.

Here, we have a synonym context clue. The word "mistake" gives away the meaning of faux pas. Therefore, we can determine that faux pas means error, mistake, or gaffe.

With the information above in mind, we can conclude that the answer provided above is correct.

Learn more about context clues here:

https://brainly.com/question/24750804

#SPJ1

justice delayed is justice denied.
can someone please explain this?
I have a competition on this topic
please...​

Answers

"Justice delayed is justice denied" means that justice should occur as fast as possible because, if it takes too long, it is as if nothing has been done.

What does the saying mean?

The saying "Justice delayed is justice denied" means justice should occur as fast as possible. Waiting for too long to make things happen when a crime has been committed only hurts the victim or their loved ones even more.

Our legal system is designed to function properly, in a timely manner, but we know things are different in real life. More often than not, especially in cases concerning high-profile crimes, justice is dragged out for as long as possible and, frequently, the outcome is not satisfactory.

Therefore, the saying "Justice delayed is justice denied" means that justice should occur as fast as possible because, if it takes too long, it is as if nothing has been done.

Learn more about sayings here:

https://brainly.com/question/27876413

#SPJ1

READ THIS FIRST: excerpt from “Solitude” by Henry David Thoreau

Henry David Thoreau was a writer and philosopher. He was a major figure in the transcendentalist movement. Transcendentalists feel a deep connection to nature. They believe people connect directly with God and are born with innate goodness. For two years, Thoreau lived in a small cabin he built in the woods. He felt people should live closer to nature instead of relying on material wealth. “Solitude” is an essay from his book Walden; of, Life in the Woods.

This is a delicious evening, when the whole body is one sense, and imbibes delight through every pore. I go and come with a strange liberty in Nature, a part of herself. As I walk along the stony shore of the pond in my shirt sleeves, though it is cool as well as cloudy and windy, and I see nothing special to attract me, all the elements are unusually congenial to me. The bullfrogs trump to usher in the night, and the note of the whippoorwill is borne on the rippling wind from over the water. Sympathy with the fluttering alder and poplar leaves almost takes away my breath; yet, like the lake, my serenity is rippled but not ruffled. These small waves raised by the evening wind are as remote from storm as the smooth reflecting surface. Though it is now dark, the wind still blows and roars in the wood, the waves still dash, and some creatures lull the rest with their notes. The repose is never complete. The wildest animals do not repose, but seek their prey now; the fox, and skunk, and rabbit, now roam the fields and woods without fear. They are Nature’s watchmen, —links which connect the days of animated life. . . .

Some of my pleasantest hours were during the long rain storms in the spring or fall, which confined me to the house for the afternoon as well as the forenoon, soothed by their ceaseless roar and pelting; when an early twilight ushered in a long evening in which many thoughts had time to take root and unfold themselves. . . . Men frequently say to me, “I should think you would feel lonesome down there, and want to be nearer to folks, rainy and snowy days and nights especially.” I am tempted to reply to such,—This whole earth which we inhabit is but a point in space. How far apart, think you, dwell the two most distant inhabitants of yonder star, the breadth of whose disk cannot be appreciated by our instruments? Why should I feel lonely? Is not our planet in the Milky Way? This which you put seems to me not to be the most important question. What sort of space is that which separates a man from his fellows and makes him solitary? I have found that no exertion of the legs can bring two minds much nearer to one another.



Part A In "Solitude," what can be inferred about the author’s feelings toward the natural world? Responses
(A) He feels that people can learn a lot from observing the interactions that take place in nature.
(B) He is afraid in the company of other people, but he has no fear around animals. (C) Every part of the natural world is equally appealing, but each in its own way.
(D) He understands the emotions of people but has much to learn about those of animals.

Question 2 Part B - Points depend on a correct response in Part A. Which sentence best supports the answer in Part A? Responses
(A) “They are Nature’s watchmen,—links which connect the days of animated life.”
(B) “The wildest animals do not repose, but seek their prey now; the fox, and skunk, and rabbit, now roam the fields and woods without fear.”
(C) “What sort of space is that which separates a man from his fellows and makes him solitary?”
(D) “As I walk along the stony shore of the pond in my shirt sleeves . . . and I see nothing special to attract me, all the elements are unusually congenial to me.”

Answers

Part A In "Solitude," what can be inferred about the author’s feelings toward the natural world is option (A) He feels that people can learn a lot from observing the interactions that take place in nature.

The sentence that best supports the answer in Part A is option (C) “What sort of space is that which separates a man from his fellows and makes him solitary”.

What is the main point of Thoreau's writing about solitude?

In "Solitude," Thoreau attempts to convince his readers of the health benefits of solitude and close contact with nature.

Through the use of simile, Thoreau compares his calmness to the still surface of a lake and the kindness he experiences from Nature to an environment that nourishes him.

We learn that what Thoreau means by "solitude" is self-communion and reflection rather than loneliness or isolation.

Therefore, Part A In "Solitude," what can be inferred about the author’s feelings toward the natural world is option (A) He feels that people can learn a lot from observing the interactions that take place in nature. The sentence that best supports the answer in Part A is option (C) “What sort of space is that which separates a man from his fellows and makes him solitary”.

Learn more about Solitude from

https://brainly.com/question/17364474
#SPJ1

Shrek thinks Greek music is loud.

Answers

Answer:

Somebody once told me...

Explanation:

Answer:

Well you see.......

Explanation:

pls hurry will give brainliest and 100 points!!
Complete the equation that represents the proportional relationship shown in the table.
Enter your answer in the box.

y=

x y
21 7
15 5
12 4

Answers

Answer: y=3x

the equation that best represents the data that is in the table is y =3x You can corroborate it by substituting the x values of the table and verifying that you get the "y" values.

Answer: y=3x

Explanation:

3. We know that the setting of this story will be Maycomb,
Alabama, a sleepy Southern town that's a little rough
around the edges. What is the time period of this story?
Give evidence to support your conclusion about the time
period of this novel.

Answers

The time period of this story "Novel" is in the 1930s.

What is novel?

A fictional prose tale that typically deals with the life experiences through a connected series of events and is long and intricate.

Therefore,

We know that the setting of this story will be Maycomb, Alabama, a sleepy Southern town that's a little rough around the edges.

What is the time period of this story?

Give evidence to support your conclusion about the time period of this novel.

The time period of this story is in the 1930s.

To learn more about Novel from the given link:
https://brainly.com/question/24371255

#SPJ9

How does your purpose for communicating relate to your genre, medium, and design choices ?

Answers

The purpose for communicating relates to the genre, medium, and design choices in this way;

If the purpose for communicating is to entertain, then lighter genre forms like poetry and drama might be used. Informational texts are often presented in prose form. The medium is also important because different kinds of audiences can be found in different places. Academicians will be found in research websites while youths and teenagers will be found online so, social media will be a good way of reaching out to them.

What is a genre of writing?

The genre of writing refers to any of the three main forms of writing. These are drama, prose, and poetry. These are used according to the intent of the writer.

To reach out to young and old people, different media of communication will be employed. Also, texts are designed in different ways to communicate ideas.

Learn more about genres of writing here:

https://brainly.com/question/25027064

#SPJ1

Your genre, medium, and design choices must be able to effectively convey your information, stance, and purpose for communicating.

Choose the item that correctly identifies the figure of speech used in the sentence and provides a word that could go in the blank of the sentence. I’m going to throw this text into my _______________ and whip up something that’s pleasant to read!

A) metaphor; word processor

B) metaphor; hardware

C) simile; word processor

D) simile; hardware

Answers

I’m going to throw this text into my option A) metaphor; word processor and whip up something that’s pleasant to read.

What is a Metaphor?

A metaphor is known to be a type of a figure of speech that, is one that brings about a  rhetorical influence and it is one that directly calls to one thing by telling another.

Therefore, based on the above, I’m going to throw this text into my option A) metaphor; word processor and whip up something that’s pleasant to read.

Learn more about metaphor from

https://brainly.com/question/9418370

#SPJ1

How could feedback from peers help in the review process?
O They can offer ideas on which sources you should quote.
O They can help clarify the purpose of your paper.
O They can suggest different thesis statements to use.
O They can select the best places for different bold-faced words.

Answers

The feedback from peers help in the review process as: They can offer ideas on which sources you should quote.

The term peer-review process refers to the evaluation of work by one or more people with similar expertise to the author and subject matter of the paper.

The feedback that offers specific advice on how to improve the paper is the most useful during the peer-review process. Accounting, law, and engineering (e.g., software peer review, technical peer review) are examples of fields where a peer-review process is widely used.

A peer feedback review is one of several different types of reviews that your company could use to evaluate your employees and their performance. Peer reviews provide a less biased and more honest view of an employee as a whole, rather than just what one or two people notice, as supervisory reviews frequently do. As a result, they can provide you with a more accurate assessment and understanding of your employees' performance.

To learn more about peer-review process, visit

https://brainly.com/question/10196430

#SPJ1

Punctuate the following passage and rewrite it.

Answers

Answer:

where is it? theres nothing, how can i rewrite it?

Which inference does this passage support?

Hindus who lived in ancient times used sugar the same way we use it today.
Hindus who lived in ancient times believed that sugar had powerful properties.
Most Hindus in ancient times had very few specific uses for sugar cane.
Most Hindus in ancient times searched for new ways to use sugar cane.

Answers

the answer should be B

Write a letter to teacher In school TELLING HIM about your Future Plans What you tends to become In Future (occupation) and reason why you really want to become that not Less than 450 words​

Answers

To write a letter to a teacher telling him or her about your future plans, you can describe your skills or reason for choosing to pursue a particular career.

How to write an effective letter?

It is essential to pay attention to the structure of the letter, which is a more direct communication, using formal or informal language according to the recipient and the degree of relationship.

Therefore, it is important to use clear and objective language, with descriptive elements for better understanding by the reader.

Find out more about writing a letter here:

https://brainly.com/question/24623157

#SPJ1

All patient histories generally contain which of the following information?

1. Descriptions of present health status or illness
2. Patient's primary care physician
3. General background information
4. Screening information

Answers

Answer:

It's 1,3,4

Explanation:

hope you get it right :)

Read the excerpt from Act II, Scene i of Julius Caesar. Then answer the question that follows.

DECIUS:
Never fear that. If he be so resolved,
I can o'ersway him. For he loves to hear
That unicorns may be betrayed with trees,
And bears with glasses, elephants with holes,
Lions with toils, and men with flatterers.
But when I tell him he hates flatterers,
He says he does, being then most flatterèd.
Let me work.
For I can give his humor the true bent,
And I will bring him to the Capitol.

Which of the following universal themes is most present in these lines from the play?

Honor is the most valuable of attributes.
Power has the ability to corrupt and ruin those it touches.
Things aren't always what they seem.
Words have the power to move mountains.

Answers

Things aren't always what they seem are the universal themes present in these lines from the play.

A major topic, subject, or message within a story is referred to as a theme in modern literary studies. One may categorize themes into two types: thematic concepts and thematic statements. Thematic concepts are what readers "believe the work is about," while thematic statements are "what the work says about the topic." Frequently, themes and premises are separated.

A concept or point that is essential to a tale and can frequently be summed up in a single word is the definition of a theme that is used today (for example, love, death, betrayal). Themes of this kind frequently include the struggle between the self and society, adolescence, the clash between people and technology, nostalgia, and the perils of unbridled ambition.

To know more about Theme here

https://brainly.com/question/11108997

#SPJ1

Is technology makes us less human

Answers

Answer:

Yes, Technology is making us feel less human: We are increasingly depending on technological devices to guide us.

Explanation:

Read the passage and then answer the question that follows:

The European Starling is no larger than the average bird. Despite its normal size, it is surprisingly harmful to farmers. The massive size of flocks (up to 750,000 at a time) is well documented. On several occasions, it has been known to destroy entire crops. All things considered, it may just be one of the most destructive species in the sky and on land.

In the passage, which transition is used to summarize an idea?

Answers

Answer: All things considered

Explanation: The last sentence concludes saying "all things considered"

In the passage, The transition is used to summarize an idea all things considered. Thus the correct option is A.

What is Summary?

A summary refers to a brief introduction of any topic in your own words to make the reader easily understand the plot and setting of any story and help them to engage effectively.

Transitions are a quick and efficient way for professionals to combine paragraphs, concepts, and textual elements. Transition words help with coherence, and understanding by logically joining text sections together.

"All things considered", is a transitional phrase because it informs the reader of what will happen in upcoming events. By taking into account all the information, it helps to develop a conclusion for the specific passage.

Therefore, option A is appropriate.

Learn more about Summary, here:

https://brainly.com/question/28846379

#SPJ5

The complete question is Probabaly

The European starling is no larger than the average bird. despite its normal size, it is surprisingly harmful to farmers. the massive size of flocks (up to 750,000 at a time) is well documented. on several occasions, it has been known to destroy entire crops. all things considered, it may just be one of the most destructive species in the sky and on land. in the passage, which transition is used to summarize an idea? all things considered is well documented on several occasions surprisingly

Read the following sentences and select the one that uses a homophone correctly.

It is estimated that 30–60 million buffalo traveled the planes in the mid-1800s in America.
She preferred her hamburgers to be plane—no condiments and no vegetables—just meat and a bun.
The mother and her children were the first ones on the plane; their seats were next to the cockpit.
The plain was flying so low the trees were rippling after it went by.

Answers

The sentence which uses homophone correctly is It is estimated that 30–60 million buffalo traveled the planes in the mid-1800s in America.

What is homophone?

Due to its potential to refer to three different types of words, homonym can be problematic. Homonyms include words like to, too, and two that have the same pronunciation but different spellings and meanings. oppositely, they could be terms that have the same pronunciation and spelling but have different meanings, like the words quail (the bird) and quail (to cringe).

Last but not least, they might be terms with the same spelling but different pronunciations and meanings, like the bow of a ship and a bow that fires arrows. It can be tricky to name the second kind because the first and second types are frequently referred to as homophones and the second and third types are occasionally referred to as homographs. Some linguists prefer to keep homonyms to the third category.

The sentence It is estimated that 30–60 million buffalo traveled the planes in the mid-1800s in America. The word aircraft gives the sentence a twofold meaning, either that the buffalo flew by plane (jet) or that the buffalo travelled by a plane, which employs homophone appropriately (land).

To know more about homophone, go to link

https://brainly.com/question/39321

#SPJ1

Answer: The mother and her children were the first ones on the plane; their seats were next to the cockpit.

Explanation:

All of the sentences use a form of the word plane, but answer C is the only one that uses it correctly by using it as airplane. hope this helps!! Sorry I'm not good at explaining

1. The use of third person point of view in this story makes the reader feel like a-
2. What is the initiating event for this story?
3.Which detail about the setting contributes to the plot of the story?
4.What does the author mean by the phrase "jumping-on-a-chair-at-the-sight-of-a-mouse" in paragraph 2
5.what does the author mean by the phrase "like stone image" in paragraph 9
6. What is the theme of this story?
7. Why is the hostess's reaction to snake important to the story?
8. How would the story have been different if it had been told from the hostess's point of view?

Answers

Answer:

the use of third person point of view in this story makes the reader feel like a

Explanation:

what is the initiating avent for this story

What are the 2 most common mistakes made when paraphrasing

Answers

Answer: GoodMorning: )✨I kinda make these mistakes when paraphrasing , but void switching out or changing around of a few words in an author's sentence(s) for use in your paper. Avoid failing to acknowledge (through an in-text citation or direct quotes) the outside source from which you obtained your information or ideas. alsoo some things that would help is - Original—paraphrases should use your own fresh vocabulary, phrasing, and sentence structure, not the sentence structure, phrasing and words of your source. 2. Accurate—paraphrases must precisely reflect the ideas, tone, and emphasis of your source.

Have a Nice day <3

Explanation:

Answer:

1 not being artistic

2 repeating key words

Read the following excerpt from "Blessings of Liberty and Education" by Frederick Douglass. Then, answer the question that follows. Thirty years ago neither poet, priest nor prophet, could have foretold the vast and wonderful changes which have taken place in the opinions of the American people on this subject since the war. The North has changed, and the South has changed, and we have all changed, and all changed for the better. What is the effect of the use of parallel structure in the sentence in bold? It creates a hopeless tone by repeated phrases with negative connotations. It elaborates on how historians were able to predict the future after the abolition of slavery. It emphasizes the transformation of the United States after the abolition of slavery. It defines the exact changes that have taken place in the American people.

Answers

The effect of the use of parallel structure in the sentence in bold is C. It emphasizes the transformation of the United States after the abolition of slavery

This is because the narrator talks about how far the United States had come since the abolition of slavery, how the North and South have progressed since then, and also the public opinion on the issue and topic.

What is Parallel Structure?

This refers to the way and manner a text is written to contain similar ideas and structure of writing.

Hence, we can see that The effect of the use of parallel structure in the sentence in bold is C. It emphasizes the transformation of the United States after the abolition of slavery

This is because the narrator talks about how far the United States had come since the abolition of slavery, how the North and South have progressed since then, and also the public opinion on the issue and topic.

Read more about parallel structure here:

https://brainly.com/question/28136978

#SPJ1

He divided the empire into
provinces, with a satrap
overseeing each province.

Answers

Darius is the one for whom the line is written He divided the empire into provinces, with a satrap overseeing each province.

What is a province?

A province can be defined as the path that is being there and entered into the nation within a territory.

Darius brought order and tranquility to the Persian Empire. He extended it just by 500 miles by capturing fresh territory. Darius split their kingdom among 20 provinces, assigning one apiece a military commander, an internal revenue service, as well as a ruler known as either a satrap.

The Royal Road was constructed and coins were produced to a standard during his reign. Within the Persian Empire, he instituted the production and interchange of metal coins with fixed values.

Learn more about Darius , here:

https://brainly.com/question/11163124

#SPJ1

The question is incomplete, the complete question will be:

For whom is the line written He divided the empire into provinces, with a satrap overseeing each province.

Which of the following best describes the purpose of a search engine?
Group of answer choices

It is an engine that runs on reliable information.

It searches through the Internet and finds websites that match your subject.

It is the box where you type in what you are looking for.

It is the list of websites that appears once you press "search."

Answers

The option that  best describes the purpose of a search engine is option B. it searches through the internet and finds websites that match your subject.

What best describes the purpose of a search engine?

A search engine is known to be a kind of a software program that enables a person to be able to find other people as well as some information that  they are known to be looking for online via the use of keywords as well as phrases.

Note that  Search engines are able to helps a person to bring back results quickly an as such, The option that  best describes the purpose of a search engine is option B. it searches through the internet and finds websites that match your subject.

Learn more about search engine from

https://brainly.com/question/512733

#SPJ1

Other Questions
Solve each system by elimination. 4x - 6y = -26 , -2x+3y = 13 What speed will you have to go from Chicago to Hackensack in 260 hours Mrs Peh paid $1438 for 1 drum set and 1 keyboard. Tim paid $690 for 1 fluteand 1 keyboard. The drum set cost thrice as much as the flute. How much would1 drum set and 1 flute cost? seven caculators cost $170.00 According to the data presented in the map, which of the following conclusions can be drawn about the population distribution in Pakistan? Pakistan has a low physiological density. Arithmetic density is highest in major cities. Agricultural density is highest in the southwest region. Population density is concentrated in mountainous regions. Physiological density is highest in the northeast. Describe the nucleus in a eukaryotic cell. An inductor is connected to an ac supply. increasing the frequency of the supply _________ the current through the inductor. Explain why you need to vertically align the decimal points when summing decimal numbers. At the north campus of a performing arts school, 30% of the students are music majors. At the south campus, 80% of the students are music majors. The campuses are merged into one eastcampus. If 65% of the 1000 students at the east campus are music majors, how many students did each of the north and south campuses have before the merger? Which functional group, if found in the r group of an amino acid, would most likely be able to form an ionic bond force with a charged amino group on another molecule?. Determine whether the events are mutually exclusive or not mutually exclusive. Then find the probability. Round to the nearest tenth of a percent, if necessary.drawing an ace or a heart from a standard deck of 52 cards For a second order reaction, the initial reactant concentration, [a]o, is 0.93 m. after 16.7 s, the concentration is 0.65 m. what is [a] after 84 s? Place these words in the correct order based onthe most gravity to the least gravity.UniverseMoonPlanetGalaxyStar Juan's professor lectures on the fact that certain features in animals have been passed down from one generation to another. what theory is juan's professor probably describing? If you have three junit test methods written in the same testing class and the first one fails its assertions, will he other methods still be executed? A bakery is making whole-wheat bread and apple bran muffins. for each batch of break they make $35 profit. for each batch of muffins, they make $10 profit. the break takes 4 hours to prepare and 1 hour to back. the muffins take 0.5 hours to prepare and 0.5 hours to bake. the maximum preparation time available is 16 hours. the maximum bake time available is 10 hours. let x = Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA In civil rights literature, which ideology was often at odds with multiculturalism? A. Disillusionment B. Symbolism C. Disenfranchisement D. Black Power Based on what you know of the peptide bonds that link together amino acid residues, why would proline's side chain reduce the flexibility of the backbone? What are "affiliates" asKing uses the word?Consider the context of how the word is used multiple times in paragraph 2.