Which learning theory is a point of view that suggests children learn by observing models ?

Answers

Answer 1

The learning theory which suggests a point a view the children's. learn by observing models as required in the task content is; The social learning theory.

Which learning theory is one which proposes that children learn by observing others as required in the task content?

It follows from the task content that the learning theory which proposes the opinion that children learn by observing others be determined.

On this simple note, since it follows from the proposition of the social learning theory that every children of most categories learn solely by way of observing models which may be any kind of or a combination of family or relatives, friends or acquaintances.

As a matter of fact, the social learning theory which is otherwise termed Observational learning, simply occurs when an observer's behavior changes after viewing the behavior of a model.

Such observer's (child's) behaviour may therefore be influenced positively or negatively.

Read more on social learning theory;

https://brainly.com/question/7049525

#SPJ1

Answer 2

Answer: Social Learning

Explanation:


Related Questions

Nora is starving after her dance recital. She grabs a protein drink, carefully looking at the label. The drink has 100 calories but 41 of those calories are from fat. Scanning down the label, Nora sees that the fat content is 5%DV. Taking into account the FDA’s standards, which statement is true of Nora’s choice?

A.
The ratio of calories to calories from fat means that Nora’s drink is not a healthy choice.

B.
The fat content does not matter since the caloric count of the drink is so low.

C.
Nora is consuming more than her recommended daily value of fat with this one drink.

D.
The protein drink’s total fat is considered a low amount of Nora’s daily recommended value.

Answers

The fat content does not matter since the caloric count of the drink is so low is the true statement when taking into account the FDA’s standards.

What is Calorie?

This is referred to as the unit of energy and is the amount of energy provided by food substances for the proper functioning of the body system.

According to FDA, there are set standards in which food substances should be eaten so as to provide the right amount of nutrients needed by the body daily. If the %DV is less than 5% then it means the nutrient is low while if it is greater than 20% then it means the nutrient is low. In this scenario, we were told that the fat content is 5%DV which is why option b was chosen.

Read more about Calorie here https://brainly.com/question/1178789

#SPJ1

Answer:

the caloric count of the drink is so low

Explanation:

Self-Awareness can help us with a condition we all face and will face for the rest of our lives. This condition can be debilitating and it can motivate us to improve. What is it? Write down three guesses that you have.

Answers

The condition that self-awareness can help us with and which can be debilitating and it can motivate us to improve include:

Self-esteemApathyDepression

What is self-awareness?

Self-awareness refers to a condition in which an individual has a consciousness of his or her thoughts, actions, abilities, strengths, weaknesses and emotions.

Self-awareness is a very important attribute or skill to acquire as it helps to shape the person an individual becomes.

Some conditions which require self-awareness include the following:

1. Self-esteem - self-esteem refers to the worth or value an individual places on himself or herself. Self-esteem can range from low to high self-esteem.

An individual with low self-esteem struggles to view himself or herself as valuable and therefore lacks motivation and confidence.

On the other hand, those with high self-esteem are confident and motivated.

2. Apathy - this is a condition in which an individual does not show any concern or regard for the things and people around them.

3. Depression - this is a mental condition in which an individual has a negative view about himself or herself or life in general.

Learn more about self-awareness at: https://brainly.com/question/26728098

#SPJ1

If you have muscles but you're trying to build more what should you do differently?

Answers

Answer:

You should eat food that is higher in proteins. But if you’re trying to build lean muscle, strength training should be your main focus, with some cardio on the back end. Low-impact cardio typically burns more calories than strength training and, if you’re doing a lot of cardio, you’ll need to refuel your body appropriately to continue to build muscle Overtraining, not enough rest

Explanation:

41
Megumi goes to the doctor, complaining of fatigue. The doctor examines her and asks if she has experienced heart palpitations, muscle cramps, or tingling in her hands and feet. She denies any of these symptoms. A blood test determines that Megumi’s magnesium reading is not right. Considering her symptoms, which is MOST likely true of Megumi?

A.
Megumi has a magnesium inadequacy.

B.
Megumi has a magnesium deficiency.

C.
Megumi has a magnesium excess.

D.
Megumi has a magnesium balance.

Answers

Megumi goes to the doctor, complaining of fatigue. The doctor examines her and asks if she has experienced heart palpitations, muscle cramps, or tingling in her hands and feet. She denies any of those symptoms. A biopsy determines that Megumi’s magnesium reading is not right. Considering her symptoms, Megumi features a magnesium deficiency.

Magnesium deficit is an electrolyte disruption caused by the body having insufficient magnesium. There could also be several symptoms as a result. Tremor, impaired balance, muscle spasms, loss of appetite, personality changes and nystagmus are among the symptoms. Seizures or asystole like that caused by a torsade de pointe, are samples of complications. Low magnesium patients frequently have low potassium levels. A variety of drugs, including proton pump inhibitors (PPIs) and furosemide, also can lower magnesium levels.

Low blood magnesium levels are often won’t to make the diagnosis (hypomagnesemia). Hypomagnesaemia is defined by magnesium levels below 0.6 mol/L (1.46 mg/dL), which fall within the traditional range of 0.6 and 1.1 mol/L (1.46-2.68 mg/dL).  There are often specific electrocardiogram (ECG) changes. Magnesium is run during treatment either orally or intravenously. Magnesium sulfate could also be administered intravenously to people who have severe symptoms.  Associated low calcium or potassium levels have to be treated as well. People that visit hospitals tend to have the condition fairly frequently.

Learn more about magnesium deficiency here:

https://brainly.com/question/7801960

#SPJ1

Explain the roles of OSHA and CDC in dentistry and patient care.

Answers

Dental offices should take documentation of infection prevention and control measures and OSHA compliance extremely seriously. Mary Govoni, RDH, CDA, a compliance and safety expert, has provided some recommendations.

Dental team members often take considerable effort to ensure that the patient records they keep adhere to the rules and standards for recording patient care. These are essential components of risk management in medical facilities. But in addition to the paperwork needed for clinical procedures and financial transactions related to patient care, dental practices also need to keep track of other kinds of paperwork.

The OSHA compliance and infection prevention and control paperwork stand out among these. In the event of an OSHA inspection, this documentation is crucial since OSHA would presume that actions like training have not been taken if they are not documented. Additionally, keeping track of safety procedures, particularly those related to infection prevention and control, helps a practice comply with state dental board regulations.

Thus, this are the roles played by OSHA and CDC.

Learn more about OSHA

https://brainly.com/question/13591663

#SPJ9

Which item meets the daily recommended allowance for proteins?

a granola bar with nuts

a chicken breast

a cup of brown rice

a glass of milk

Answers

a granola bar with nuts item meets the daily recommended allowance for proteins.

What is protein ?

proteins are the  Primary structural unit of cell which  is the linear ordering of amino acids, bound by Covalent, peptide bonds to form primary structure.

There are different forms of protein like primary, Secondary structure refers to locally folded structures  due to hydrogen bonding  between the amine and carboxyl group.

These structure present in two forms like α – helix form and beta sheet form, where alpha helix form is a polypeptide chain of hydrogen bonds by twisting into a right-handed screw with the -NH group of each amino acid residue.

Learn more about protein, here:

brainly.com/question/14652022

#SPJ1

Answer: BROOO I took the test and put a granola bar with nuts like the guy above said AND GOT IT WRONG ...... the real answer is a chicken breast..... I tryed to put screenshot but did not work

Explanation:

DO NOT listen to the guy above the answer is a chicken breast.

Which of the following is an example of an inclusive term?

Answers

"We must work together to ensure no child goes hungry." is referred to as an example of an inclusive term and is denoted as option D.

What is Inclusive term?

This refers to the words and phrases which are used in writing and doesn't depict bias or discrimination about any group of people or organization. I this type of term there is no racial or gender differences as everyone is referred to as the same.

We must work together to ensure no child goes hungry." is an inclusive term because the 'we' which is used represents a uniform group of people which is therefore the reason why it was chosen as the most appropriate choice.

The options are:

a. “Wait up, guys!”

b. “Yes, she’s a housewife.”

c. “Mr. and Mrs. Carter will be attending the gala tonight.”

d. "We must work together to ensure no child goes hungry."

Read more about Inclusive term here https://brainly.com/question/15012648

#SPJ1

How can a stereotypes to sexuality be limiting and harmful one's personality?

Answers

Stereotypes often pave way for intergroup hostility and toxic prejudices around age, race, and other social distinctions.

What are some reasons why a patient may become non-compliant? How can a medical assistant encourage a patient to continue physical Therapy and rehabilitation?

Answers

A patient may become non-compliant because of cost and affordability of treatment.

Briefing :

Among the frequent causes of non-compliance and non-adherence are some of the following: Price and accessibility. Inability to understand or comprehend advice, whether due to linguistic or cognitive limitations, a fear of seeking clarification, or for other causes. Having a weak patient-provider relationship or harboring mistrust.

How can we help non compliant patients?

Managing the non-compliant person can be done by using the following verbal intervention strategies:

Keep your head on straight.

Put responsibility in its proper place.

Tell them what the order is.

Set sane boundaries.

Be ready to enforce your boundaries.

Don't focus on the bad.

What are barriers to compliance?

Barriers are multifaceted and include factors related to the health system, mental health issues, and treatment-related problems (such as side effects) (e.g., lack of care coordination). The significance of social determinants of health has also come into focus in recent years.

To know more about health :
https://brainly.com/question/13179079

#SPJ9

why we need sleep and
what happens if we don't get
enough sleep, including potential
physical, emotional, social, and
safety threats to health.

Answers

Not getting enough sleep can weaken your immune system, cause thinking issues, and lead to weight gain. It also increase your risk of certain cancers and diabetes

Which Remark Code would appear, N210 or N211?

Answers

Answer:

second one

Explanation:

N211

How do you define health?

Answers

Health is your physical and mental body, and body parts

Luna is in the grocery store with her young son, shopping for milk. The young boy picks up a container to put in the shopping cart, but Luna says, “Not that one. It is unpasteurized. We need the pasteurized one.” She selects another container. Her son asks what the difference is between the two as the containers look almost identical. Which is the SIMPLEST way for Luna to explain the difference?

A.
Pasteurization is a process developed by scientist Lois Pasteur, who discovered that microorganisms are present in milk.

B.
Unpasteurized milk can contain pathogens or microorganisms that can cause illness.

C.
Pasteurized milk has added salt to kill off any bad bacteria.

D.
Pasteurized milk is just milk that has been warmed up to kill bacteria.

Answers

Answer:

B

Explanation:

unpasteurized milk can contain pathogens or microorganisms that can cause illness.

Out for breakfast with her family, Lily’s eyes dart to the bottom of the menu she was handed where there is an asterisk and sentence that says, ‘Eating some uncooked foods can put a person at risk of contracting salmonella.’ Lily looks back up to find which menu item this asterisk refers to. Which food will she MOST likely find attached to this warning?

A.
eggs

B.
waffles

C.
blueberry preserves

D.
sausage patties

Answers

Answer:

A, eggs.

Dirty eggs may have harmful Salmonella bacteria on the shell. Cracked eggs allow Salmonella to enter and grow inside the egg. However even eggs with clean, uncracked shells can pose a risk if handled incorrectly.

Answer is A because uncooked eggs can give someone salmonella :] hope this helps!

If pregnancy occurs, what continues to produce estrogen and progesterone?
A. Pituitary gland
B. Corpus luteum
C. Vagina
D. Uterus

Answers

Answer:

B. Corpus luteum

Explanation:

Corpus luteum is an endocrine gland within the ovary

Pituitary gland makes :

Corticotropin

Vasopressin

Follicle-stimulating (HAIR !!!) hormone (FSH)

Growth hormone (GH)

Luteinizing hormone (LH)

Oxytocin.

Prolactin.

Thyroid-stimulating hormone (TSH)

NIH

cleveland clinic

If a fertilised egg implants in the lining of the uterus, the corpus luteum continues to produce progesterone, which maintains the thickened lining of the uterus. If pregnancy does not occur, the corpus luteum dies, progesterone levels drop, the uterus lining sheds and the period begins again.

The psychologist who would argue that the unconscious mind plays a key role in human behavior is: Wilhelm Wundt. William James. Sigmund Freud. Martin Seligman.

Answers

The psychologist who would argue that the unconscious mind plays a key role in human behavior is Sigmund Freud and is therefore denoted as option C.

What is Freudian theory?

This was coined by the psychoanalyst which is referred to as Sigmund Freud and states that the behavior and personality arose as a result of interaction between the psychological forces which operate on the three levels of awareness and they are referred to as the following below:

PreconsciousConsciousUnconscious.

He also proposed that the adult personality is made up of three aspects which include:

The id.The egoThe superego.

Though he didn't discover the unconscious aspect of the mind but he made it popular which is why it is used today when studying human behavior which is therefore the reason why Sigmund Freud was chosen as the most appropriate choice.

Read more about Sigmund Freud here https://brainly.com/question/6401105

#SPJ1

Imani hosts a party, preparing a turkey with several side dishes. Imani’s guests eat until they are stuffed but there is still plenty of food on the table. Even though the party will last until the early hours of the morning, when should Imani wrap and put away the leftovers?

A.
after everyone heads home

B.
within two hours of serving

C.
once dessert is served

D.
the morning after the party

Answers

Answer:

A, after everyone heads home

According to the textbook, the example of the senior in college showed that:
Group of answer choices

college is easy for everyone

stress can cause health issues if not addressed

high school does not cause stress

the body and stress are two separate things that are not related
i dont know the example what makes more sense

Answers

i think the statement,

"stress can cause health issues if not addressed"

makes the most sense.

3. Food grown on depleted soils is nutritionally inferior true or false

Answers

Answer: true

Explanation:

A chemical formula indicates both the ______ and number of atoms in a molecule.

Answers

Answer:

elements

Explanation:

Through the endocrine system, hormones regulate many body functions. List four functions that are regulated by hormones.

Answers

Mood, growth, and development, the way our organisms work, metabolism and reproduction

Whats important to nutrition but is not a nutrient

Answers

Answer:

Non-essential elements/non nutrients and includes dietary fibre, amino acids and antioxidants.

Explanation:

Non-essential elements or non nutrients refers to elements that are either synthesized in the body or taken from food eaten but required by body for normal functioning.

Which of the following phrases shows the uses of praise followed by reasoning when encouraging self-esteem?

Answers

Answer: Praise can be beneficial, but it isn't the only way that parents communicate their approval, acceptance, encouragement, love

Explanation:

Answer:

"Thank you for doing a good job cleaning up the water on the floor. Now, no one will fall."

Explanation:

__________describes when a person can easily move multiple parts of their body at the same time

Answers

Agility describes when a person can easily move multiple parts of their body at the same time.

The ability to use your senses in combination with your own body parts, or the ability to use two or more body parts together. Strength is the Agility to move a body part quickly while exerting maximum muscle strength. Strength is a combination of speed and strength. Strength is the ability to move a body part quickly while exerting maximum muscle strength. Strength is a combination of speed and strength.

Body coordination is the ability to move multiple parts of the body simultaneously, effectively, and efficiently. Velocity is defined as the ability to move the body as fast as possible in one direction. Agility is the ability to accelerate, decelerate, stabilize, and change direction quickly with correct posture. Velocity is the ability to exert maximum force to react and change body position.

Learn more about Agility here:-https://brainly.com/question/13857293

#SPJ9

45
Logan is taking a tour of a factory where vegetables are canned and then shipped to grocery stores. The tour stops in front of a line canning green beans. Which is the correct order of the canning process?

A.
cleaning the green beans, canning them, removing air to seal, then heating the containers

B.
canning the green beans, cleaning them, heating the containers, then removing air to seal them

C.
heating the containers, canning the green beans, removing air to seal them, then cleaning the beans

D.
removing air from the green beans, cleaning them, canning them, then heating the containers

Answers

The correct order of the canning process of the green beans is: (a) cleaning the green beans, canning them, removing air to seal, then heating the containers.

Canning process is the method of preservation of food to increase their shelf life and use them for a longer time. In this process both the food as well as the storage containers are sterilized in order to ensure that the food remains preserved and does not gets destroyed after canning.

Heating is a method of sterilization in order to kill the microorganism present in any substance. It is a practice performed not only in food products but also laboratories, industries, etc. Heating can be dry heating or stem heating according to the product being sterilized.

To know more about heating, here

brainly.com/question/24167810

#SPJ1

2023 ahip final exam review

Answers

Answer:

In 2023 new board system

As a child enters preschool age, which physical developmental milestone will they reach?

A- They can express many different emotions.

B- They can kick a soccer ball.

C- They can match an object to a picture.

D- They can take turns while playing.

Answers

I think it’s they can kick a Soccer ball

Answer: B- kick a soccer ball

Explanation: I got it right on the test.

Why was George “sour” about the bus driver?

Answers

because the bus driver had previously insulted him.

hope this helps!

It is important to wash raw seafood, turkey, or chicken before you begin to prepare it.

A.
True

B.
False

Answers

Answer:

yes.

Explanation:

Answer: A. True

Explanation:

, too much, or too little Cortisol can be problematic.
Group of answer choices

True

False

Answers

TRUE

If having too much or too little can wreak havoc
Other Questions
For a second order reaction, the initial reactant concentration, [a]o, is 0.93 m. after 16.7 s, the concentration is 0.65 m. what is [a] after 84 s? Place these words in the correct order based onthe most gravity to the least gravity.UniverseMoonPlanetGalaxyStar Juan's professor lectures on the fact that certain features in animals have been passed down from one generation to another. what theory is juan's professor probably describing? If you have three junit test methods written in the same testing class and the first one fails its assertions, will he other methods still be executed? A bakery is making whole-wheat bread and apple bran muffins. for each batch of break they make $35 profit. for each batch of muffins, they make $10 profit. the break takes 4 hours to prepare and 1 hour to back. the muffins take 0.5 hours to prepare and 0.5 hours to bake. the maximum preparation time available is 16 hours. the maximum bake time available is 10 hours. let x = Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA In civil rights literature, which ideology was often at odds with multiculturalism? A. Disillusionment B. Symbolism C. Disenfranchisement D. Black Power Based on what you know of the peptide bonds that link together amino acid residues, why would proline's side chain reduce the flexibility of the backbone? What are "affiliates" asKing uses the word?Consider the context of how the word is used multiple times in paragraph 2. The frequency of a microwave signal is 9.76 ghz. what is its wavelength in meters? help me asap im in a dba back to basics exam and didnt study Imagine that an employer purchases a health insurance plan that costs $365 per month, but requires that the employee pay $35 per month toward the cost of the plan. If the employee's salary is What is the slope of the line that passes through the points (6,2) and (-18,2) If you had to choose one scene from Equianos story to turn into a visual illustration in order to capture his narrative, which one would it be and why? A 78-year-old man is admitted to the emergency department (ed) with bradycardia resulting from overdose of donepezil. the nurse knows that the ed is likely to order which medication? If you see a 1st quarter moon today, what will people on the other side of the earth see later today? What elected group's laws and regulations make laboratory safety a legal requirement in the united states of america? After administering medication to a client subcutaneously, the nurse removes the needle at the same angle at which it was inserted. which explains the nurse's action? Which atoms has smaller ionization energy What is the wavelength, in nanometers, of the bright line of the hydrogen emission spectrum corresponding to the following transition?.