WHICH OF THE FOLLOWING DEMOSTRATE THE CENTRAL DOGMA OF MOLECULAR BIOLOGIST

The impact of resveratrol treatment on mammalian muscle cells' short-term atp synthesis • No ATP synthesis; reduced ATP synthesis

The quantity of energy released during aerobic respiration is a significant benefit. Only two pyruvate molecules (ATP) can be produced from glucose by organisms in the absence of oxygen.In the presence of oxygen, organisms may convert glucose into carbon dioxide. The rate declines as the product to substrate ratio rises. Your respiratory and circulatory systems are unable to deliver oxygen to the muscle cells quickly enough to sustain aerobic respiration during these intervals. This is especially true for the muscles in your legs. Your muscle cells employ the lactic acid fermentation process to enable the ongoing generation of some ATP synthesis.

Learn more about ATP

https://brainly.com/question/14637256

#SPJ4

An adaptation that the sea spider has for gathering food and conserving energy Gathering Food. Option A.

Many spider crabs have colors and patterns that match the algae and other organisms on the sea floor. Some have bright colors to ward off predators. They use a tubular proboscis to capture food or feed on microbes. Spider crabs reproduce by forming mating groups in which males collect and fertilize eggs from females.

The father then takes care of the eggs and offspring. Spider crabs are a widespread and phylogenetically important group of marine arthropods. As the spider grows, its skin becomes more sacred and can fuel its larger body by absorbing the abundant oxygen packed in cold water. It has also been found to be useful in obtaining.

Learn more about An adaptation here:-https://brainly.com/question/1213023

#SPJ9

E. coli bacteria typically dwell in the intestines of healthy humans and animals. E. coli is typically not harmful.

a) A typical gram-negative rod bacterium is Escherichia coli. Its measurements are those of a cylinder with a radius of roughly 0.5 micrometers and a length of 1.0–2.0 micrometers.

b) Using a bioinformatic method, we examined the E. coli proteins that target host cell subcellular compartments, such as the ER, Golgi complex, peroxisomes, nucleus, mitochondria, and cytoplasm, which are implicated in the growth and progression of colon cancer.

c) One kind of bacteria is E. Coli. Since they are prokaryotes, bacteria lack membrane-bound organelles. Since a nucleus is a membrane-bound organelle, it is not present in bacteria.

To know more about E.coli, visit-

https://brainly.com/question/27795628

#SPJ13

Fat would provide most of the energy that this person would need to survive.

Lipids include а diverse group of compounds thаt аre united by а common feаture. Lipids аre hydrophobic, or insoluble in wаter, becаuse they аre nonpolаr molecules. This is becаuse they аre hydrocаrbons thаt include only nonpolаr cаrbon-cаrbon or cаrbon-hydrogen bonds. Lipids perform mаny different functions in а cells. Cells store energy for long-term use in the form of lipids cаlled fаts.

Fаt is the most cаlorie dense food аnd hаving а storаble, high cаlorie compаct energy source would be importаnt to survivаl.

For more information about fats refer to the link:

https://brainly.com/question/27084380

#SPJ4

The sympathetic division of the ans is also called the thoracolumbar  division as it arises from the thoracic and lumbar regions of the spinal cord.

The peripheral nervous system's autonomic nervous system controls physiological functions that are carried out automatically, such as digestion, blood pressure, respiration, and sexual desire.

The thoracolumbar division of the autonomic nervous system is the part of the body that is responsible for kicking off the "flight or fight" reaction when the body is under stress.

Therefore, The sympathetic division of the ans is also called the thoracolumbar division as it arises from the thoracic and lumbar regions of the spinal cord.

Learn more about thoracolumbar division on :

brainly.com/question/29507759

#SPJ1

A few normal adult cells retain the ability to divide indefinitely, replacing cell lineages that die out. – These immortal cells are called stem cells.

In cell biology, the process of mitosis (/matoss/), during which replicated chromosomes are split into two new nuclei, is a stage of the cell cycle. The number of chromosomes is maintained in the genetically identical cells produced by cell division.

Immortalized cell lines are cells that have been made to reproduce endlessly so they can be grown in cultures for a long time. Immortalized cell lines come from a range of origins, such as cancers, that have chromosomal defects or mutations that allow them to divide indefinitely.

To know more about  immortal cells visit:-

https://brainly.com/question/274381

#SPJ4

In order to decode the genetic code of a cell, transcription is the initial step. RNA polymerases, a class of enzymes involved in transcription, create complementary RNA molecules to a section of one strand of DNA during the transcription process.

The RNA polymerase

RNA polymerase, the primary enzyme responsible for transcription, builds a complementary strand of RNA using a template made of single-stranded DNA. A new nucleotide is added to the 3' end of an RNA strand as it is constructed by RNA polymerase, specifically in the 5' to 3' direction.

RNA polymerase, an enzyme, and many supporting proteins known as transcription factors are responsible for carrying out transcription.

To know more about transcription visit:-

https://brainly.com/question/14136689

#SPJ4

The enhancers of all the genes contain the same set of control elements.

The term "gene" has a variety of meanings in biology. The single - molecule gene is a sequence of DNA nucleotides that's also transcribed to generate a functional RNA, whereas the Mendelian gene is the fundamental unit of heredity. Protein-coding genes as well as noncoding genes are the two categories of molecular genes. DNA will be first copied into RNA during gene expression. The RNA may perform a specific function directly or may serve as an intermediate template for just a protein. The basis for the inherited wealth of phenotypic traits is the transfer of genes to an organism's progeny.

To learn more about genes from the given link :

https://brainly.com/question/8832859

#SPJ4

Biogeochemical cycles move through abiotic and biotic regions.

They are the connection and movements

that exist between living elements (biotic

factors) and non-living elements (abiotic

factors) in order for energy to flow.Biotic and abiotic factors are what make up ecosystems. Biotic factors are living things within an ecosystem; such as plants, animals, and bacteria, while abiotic are non-living components; such as water, soil and atmosphere. The way these components interact is critical in an ecosystem.Both these components are reliant on each other. Suppose if one of the factors is removed or altered, its repercussions will be faced by the entire ecosystem. Without a doubt, abiotic factors directly affect the survival of organisms.

To know more about Biotic and the abiotic visit:https://brainly.com/question/19535386

#SPJ4

When he observes the cells under the microscope for an extended period of time, The cells have dissolved, destroying the cell walls.

To learn more about microscope from the given link :

https://brainly.com/question/18661784

#SPJ4

The central dogma of molecular biology the information flows from genes (DNA) to mRNA to proteins (amino acids).

The term Central Dogma has been defined as the term that refers to the two step process through which information flows from the sequence of DNA into a sequence of RNA (the process of transcription) and finally takes the form of proteins (the process of translation).

This is the process that ensures that genetic information of all living organisms is preserved and transmitted without any alteration or changes into their offspring and Francis Crick was the first scientist who proposed the term of "Central Dogma".

Therefore, The central dogma of molecular biology the information flows from genes (DNA) to mRNA to proteins (amino acids).

Learn more about molecular biology on:

https://brainly.com/question/19138651

#SPJ1

The correct answer is c. Amoebozoa

Unique structures called pseudopods belong to Amoebozoa.

Protists that are unique among amoebozoans are those that have pseudopods. Pseudopods are transient, cell membrane-based protrusions that serve as means of propulsion and/or feeding. A notable characteristic of an Amoeba's movement is that it resembles crawling. Pseudopods are formed by the cell near the front.

An Amoeba's cytoplasm is made up of plasmasol and is encircled by a more viscous plasma gel. The cytoplasm slides and forms a pseudopodium in front as the plasma gel transforms into plasmasol, propelling the cell forward.

Amoeboid movement is the name for this type of movement. Amoebozoan cells can be separated into two layers of cytoplasm: ectoplasm and endoplasm. The ectoplasm is the transparent outer layer of the cytoplasm, whereas the endoplasm is a granular inner bulk.

To learn more about Amoeba do visit-

https://brainly.com/question/8227

#SPJ4

Answer:

0.06mm

Explanation:

3÷50=0.06

0.06mm

When a circular DNA gets underrotated by the action of cellular enzymes, the DNA is said to exhibit Negative supercoiling.

To know more about DNA check the below link:

https://brainly.com/question/16099437

#SPJ4

In Mendel's experiment with the pea plant, the phenotypic ratio of the f2 generation of the dihybrid cross was 9:3:3:1.

Four phenotypes can be seen in the F2 generation, which results from the cross of two such plants. In the ratios of 9:3:3:1: round and green, round and yellow, wrinkled and green, and wrinkled and yellow.

By definition, a cross between two F1 people produces the F2 generation (from F1 generation). A 3:1 ratio was observed as a result of Gregor Mendel's tests across three generations (i.e. for every three purple-flower-bearing plants there would be one white-flower-bearing plant)

To know more about Mendel's visit:-

https://brainly.com/question/3186121

#SPJ4

The patella (kneecap) is situated in the patellofemoral groove of the femur, at the front of the knee joint. The patellar ligament is linked to its inferior side, and the quadriceps tendon to its superior side.

It is the largest sesamoid bone in the body and is categorized as a sesamoid type bone because of its location within the quadriceps tendon. This article will examine the patella's anatomy, including its surface characteristics, physiological purposes, and clinical applicability. Although partial patellar resection and internal fixing methods have been described, fractures near the base of the patella typically don't need surgery  76-78 Only if the quadriceps apparatus is completely disrupted (i.e., the stifle cannot be extended), the fracture gap is greater than 5 mm on radiographs, an articular fragment is obviously misaligned, or the fragments can be felt under the skin should surgery be tried.

Learn more about to patella visit here:

https://brainly.com/question/28891315

#SPJ4

The zone which contains permeable materials that are totally filled with water is the Saturated zone of groundwater.

Water found beneath the surface of the Earth in the pores of soil and rock, as well as in fractures in rock formations, is referred to as groundwater.

What are the Groundwater Saturated and Unsaturated Zones?

The soaked zone of groundwater alludes to the zone wherein pores and rock cracks are loaded up with water as it were. The water table is the name given to the uppermost portion of the saturated zone.

Air and water pores make up the unsaturated zone, which is located below the saturated zone. This zone also contains rocks and soils. It is difficult to find water that can be used by humans.

So, there is water in the saturated zone, and there is air, soil, rock, and water in the unsaturated zone.

Learn more about groundwater here:

brainly.com/question/13160768

#SPJ4

answer..... saturated zone and water table

The vagina stores a large amount of glycogen during the reproductive years, which Lactobacillus acidophilus ferments to produce lactic acid and an acidic environment. Before and after menopause, glycogen is missing.

Age, ethnicity, and physiological elements including monthly hormone variations and the immune system all have an impact on the vaginal microbiota's extremely dynamic composition.

Sebaceous glands secrete the lipid-rich material known as sebum by joining with the hair follicle to form the pilosebaceous unit. Sebum is a hydrophobic coating that serves as an antibacterial barrier, lubricant, and shield for the skin and hair.

To know more about microbiome visit:-

https://brainly.com/question/28436387

#SPJ4

The r model of growth in aphids depends on the average temperature where the population lives, thereby effectively climate change can affect population growth and an increase in average temperature may lead to overpopulation or extinction of the insect population.

The r model of growth (also called latent growth) is used to indicate exponential growth when certain climate features are reached, ie, in absence of environmental constraints. This type of exponential growth (r model of growth) is characteristic of some groups of insects.

The presence of external new factors such as a sudden raise in the average temperature may drastically affect the number of individuals in species under an r model of growth.

Therefore, with this data, we can see that the r model of growth is affected by climate variables and therefore climate change may alter the number of individuals in the target population.

Learn more about the r model of growth here:

https://brainly.com/question/13427229

#SPJ1

Internal heating from the decay of radioactive isotopes of uranium, thorium, and potassium, as well as long-term secular cooling of the earth and heat from the core, are the primary sources of thermal energy for mantle convection.

The movement of the mantle as it transfers heat from the white-hot core to the brittle lithosphere is described as mantle convection. The mantle is heated from below and cooled from above, and its overall temperature drops over time. All of these factors play a role in mantle convection.

Mantle convection is the slow creeping motion of the Earth's solid silicate mantle as convection currents transport heat from the interior to the planet's surface. The lithosphere of the Earth's surface sits on top of the asthenosphere, and the two make up the upper mantle. Hot rocks advect heat upward, while cold rocks advect cold downward; this counterflow is equivalent to an upward heat flux.

To learn more about convection in the mantle, here

https://brainly.com/question/12265809

#SPJ4

The hormone that helps the body resist stress and makes stored nutrients available to prepare the body for action would be Cortisol.

The main stress hormone, cortisol, elevates blood sugar (glucose), improves the brain's utilization of glucose, and increases the availability of substances that repair tissues. Furthermore, cortisol inhibits activities that, in a fight-or-flight scenario, would be unnecessary or harmful. Your kidneys' endocrine glands, the adrenal glands, produce and release the steroid hormone cortisol. Your body's response to stress is the primary aspect of cortisol's influence on your body.

Since it plays a role in how the body reacts to stress, cortisol is frequently referred to as the stress hormone. Blood pressure and immune responses are all increased, along with blood sugar and sugar levels. produced by the pituitary and hypothalamus in response to intense physical activity, excitement, and orgasm, and has analgesic properties.

Learn to know more about Stress on

https://brainly.com/question/18339187

#SPJ4

Using the theories of chromosome, we got that GATGACATGGCGTCAGTCGATGCG is the DNA sequence of a whole chromosome in the last step of shotgun sequencing.

Shotgun sequencing is the laboratory technique for determining the DNA sequence of an organism’s genome. The method actually involves randomly breaking up the genome into the small DNA fragments that are sequenced individually. A computer program looks for the overlaps in the DNA sequences, using them to reassemble the  fragments in the correct order to reconstitute the genome

Hence, during  the last step of shotgun sequencing, a computer analyzes a large number of fragment sequences to determine the DNA sequence of a whole chromosome, the DNA sequence is GATGACATGGCGTCAGTCGATGCG.

To know more about chromosome, visit here:

https://brainly.com/question/1596925

#SPJ4

The majority of control over gene expression occurs at the transcriptional level, mostly as a function of proteins binding to particular DNA information locations.Environmental and genetic variables affect gene expression. The genomic architecture of gene expression has considerably advanced over the years.

the method through which a gene product uses information from the gene." Gene expression enables genes to work in the body by transferring information from one gene to another, ensuring that each gene performs as intended.

learn more about gene expression here:

https://brainly.com/question/10343483

#SPJ4

Most of an atom's mass comes from the protons and neutrons that make up its nucleus. The electron is the least massive particle in the atom, with a mass of 9.11 x 10-31 kg, too small to be measured by current techniques.

The current atomic model can be decomposed into three elements protons neutrons and electrons. Each of these moieties has an associated charge, protons have a positive charge, electrons have a negative charge, and neutrons have no net charge. Each electron follows a specific path around the nucleus.

The diagram below shows some elementary particles. The atomic structure of matter consists of protons electrons and neutrons. Protons and neutrons form an atomic nucleus surrounded by electrons that belong to atoms. The atomic number of an element represents the total number of protons in its nucleus.

Learn more about An atom here:-https://brainly.com/question/17545314

#SPJ9

An organism needs one or more copies of the dominant allele A and one or more copies of dominant for all four qualities to be dominant.

a homozygous parent with one

All of the kids will have the same phenotype of the dominant characteristic if the homozygous parent carries both of the aforementioned dominant alleles. To put it another way, there is a 100% chance that a child born from such a pairing will display the dominant phenotype.

Only when both the mother and the father contribute an a gamete may an aa individual be produced. The likelihood of each parent producing a gamete is 50%. The likelihood of having an offspring with the gene aa is therefore (probability of mother contributing a) x (probability of father contributing a) = (1/2) (1/2) = 1/4.

To know more about dominant phenotype  visit:-

https://brainly.com/question/25332551

#SPJ4

Recent evidence suggests that the amygdala plays a particularly central role in the modulation of emotion.

The amygdala is widely thought to be the neural system's core for processing fearful and threatening stimuli, including threat detection and activation of appropriate fear-related behaviors in response to threatening or dangerous stimuli. The amygdala is in charge of processing strong emotions like fear, pleasure, or anger. It may also send signals to the cerebral cortex, which is in charge of conscious thought. Physical reactions are controlled by signals sent from the thalamus to the autonomic nervous system and skeletal muscles.

The amygdala's primary function is to regulate emotions such as fear and aggression. The amygdala is also involved in associating emotional meaning to memories, Decision-making and reward processing.

To learn more about amygdala, here

https://brainly.com/question/9888781

#SPJ4

Using the theories of the cell, we got that Scratches and fingerprints on the surface of the cell can decrease the amount of light that reaches the detector is the reason not to leave fingerprints or scratch the sample cells in spectrophotometric measurements.

This instrument depends on a careful usage to measure accurately the concentration in an specific solution. The wavelength can be inaccurate if some procedures were not done during the preparation process.  

When cleaning the cuvette or manipulating it, always use a lint free cloth and make sure that you removed any drops of water that might have fallen into the cuvette.

Hence, the reason  not to leave fingerprints or scratch the sample cells in spectrophotometric measurements is because Scratches and the fingerprints on the surface of the cell can decrease the amount of light that reaches the detector.

To know more about cells, visit here:

https://brainly.com/question/3142913

#SPJ4

Best evidence that all life evolved from prokaryotic rather than eukaryotic ancestors is : the oldest fossil form of life known is prokaryotic.

The evidence that show that life evolved from prokaryotic ancestors is that the oldest fossils found are prokaryotes. The oldest bacterial fossils is of about 3.5 billion years ago whereas the oldest eukaryotes discovered are about 2.1 billion years old.

Microbial mats or large biofilms represent the earliest forms of prokaryotic life on Earth.

The hypothesis is that eukaryotic cells evolved from a symbiotic association of prokaryotes which is called endosymbiosis. It is well supported by studies of mitochondria and chloroplasts, which are thought to have evolved from bacteria residing in large cells.

To know more about evolution, refer

https://brainly.com/question/12271572

#SPJ4

In general, risk assessment would be preferable than constant vigilance for a prey animal.

Under the pressure of natural selection, predators have developed a variety of physical adaptations for locating, catching, killing, and digesting prey. These consist of swiftness, dexterity, stealth, keen senses, teeth, claws, filters, and adequate digestive systems.

Animals that have evolved vigilance behaviors keep an eye out for potential hazards in their environment (Quenette, 1990; Treves, 2000; Beauchamp, 2015).

In general, risk assessment would be preferable than constant vigilance for a prey animal. The prey would be aware of their surroundings and search for signs of potential harm, such as the presence of a predator.

To know more about prey animal visit:-

https://brainly.com/question/813932

#SPJ4