Why is it important to take rock core samples?

Answers

Answer 1

Answer:

to learn about its history/formation

Explanation:

Answer 2
Core samples are vital when it comes to evaluating oil and gas reserves because one single rock sample can reveal a slew of details regarding a reserve's history, content, and the format of the geological structure.

Related Questions

​Which of the following structures are found in eukaryotes, but not prokaryotes?

Choose 1 answer:

(Choice A) Golgi body

(Choice B) Cytosol

(Choice C) Cilia

(Choice D) Cell membrane

Answers

i’m pretty sure the answer is A

The structures that are found in eukaryotes, but not prokaryotes are:

Golgi bodyCilia. Both prokaryotic and eukaryotic cells contain cytosol and cell membrane structures.

The Golgi apparatus is known as a cellular organelle whose function is to handle the proteins synthesized by the endoplasmic reticulum.

It is found in eukaryotic cells and is responsible for completing the production process of certain proteins.

Cilia are a series of short and numerous mobile extensions of the plasma membrane that line the cell surface of some eukaryotic cells.

Prokaryotic cells form living unicellular organisms, they present their genetic material dispersed in the cytoplasm, because they lack a cell nucleus.

Its cell membrane is responsible for delimiting the organism, which also lacks any type of organelle or cell divisions.

Therefore, we can conclude that the structures that are found in eukaryotes, but not prokaryotes are: Golgi body and Cilia and both prokaryotic and eukaryotic cells contain cytosol and cell membrane structures ..

Learn more here: https://brainly.com/question/776836

I will give brainliest!!!!!!!
Protein synthesis can occur on the rough endoplasmic reticulum (ER) but not on the smooth ER.

Which cell structures are attached to the surface of the rough ER that allow it to make proteins?

Choose 1 answer:

A
DNA strands

(Choice B)
B
Vacuoles

(Choice C)
C
Chloroplasts
(Choice D)
D
Ribosomes

Answers

Answer:

The answer is b

During __ cell become specialized to peform certain functions

Answers

Answer -
Cell differentiation is how generic embryonic cells become specialized cells. This occurs through a process called gene expression.

Question 6 (Multiple Choice Worth 5 points)
(01.01 LC)
Which career is in the field of agriscience?
Pediatrician
O Food scientist
O Mayor
Athletic trainer

Answers

Answer:

food scientific

Explanation:

application of scientific principles to agriculture. so food scientific to make short.

Answer: Food science

Explanation: Agriscience is the study of agriculture, natural resources, animal science, plant science (horticulture), and food science.

Which organelles are found in plant cells but not in animal cells?

Answers

Answer:

Organelles that are found in plant cells, and not in animal cells, are chloroplasts, a call wall, specialized plastids, and a large central vacuole.

Hope you found this helpful <3

Answer:

cell wall and chloroplast

Explanation: hope this helps:)

what is the role of rabbit in food chain ?​

Answers

Answer:

Rabbits are herbivores

Explanation:

Rabbit are herbivorous and directly depends on the green plants generally grasses for supply of food and energy. It is found at the second position in the foodchain. We can say that the rabbit is primary consumer in food chain. It is also link between the foodchain of grassland and forest.

Answer:

The controller that keeps plant life in check

Explanation:


What is the function of an enzyme? CHECK ALL THAT APPLY

Answers

Answer:

this is less helpful for you

Enzyme is a biocatalyst type of protein which can increase the rate of chemical reaction by reducing activation energy.

What are the properties of an enzyme ?

Enzymes are protein catalysts which enhance  the rate of biochemical reactions, it is pH-specific, catalyze both forward and reverse type of biochemical reaction but do not determine in which direction the reaction goes.  

An enzyme have active site where the substrate bound to form desired product and the enzyme increase the rate of reaction by reducing the activation energy.

Several factors which shows their effect on the action of the enzyme like heat, temperature and varying pH, it shows absolute, relative, group, stereo-specificities and regulatory function.

The Physical properties of enzyme include  act as colloid and inactivated below boiling point of water, are thermos-labile which can withstand temperatures of 100 degrees.

Learn more about enzyme, here:

https://brainly.com/question/1419573

#SPJ6

Which of the following is a function of proteins? (AKS 1a)
O A.
A. long term energy storage
O
B. help with slowing down chemical reactions
O
C. build tissues such as bone and muscle
O
D. raise activation energy and lower reaction rate

Answers

Answer:

ans is A long term energy

storage

Long term energy storage

I will give brainliest!!! Part of the Golgi body membrane can pinch off and move away to other parts of the cell. What is the purpose of this process? Choose 1 answer: (Choice A) A To collect amino acids for protein synthesis. (Choice B) B Producing ATP for the cell (Choice C) C To send messages to the nucleus (Choice D) D To deliver proteins to other locations in the cell

Answers

Answer:

d-to deliver proteins to other locations in the cell

Explanation:

i just know

The purpose of the pinching off the Golgi membrane is to deliver proteins to other locations in the cell. The correct option is D.

What is Golgi body?

The Golgi apparatus is an organelle found in most eukaryotic cells. It is also known as the Golgi complex, Golgi body, or simply the Golgi.

It is a component of the cytoplasmic endomembrane system that packages proteins into membrane-bound vesicles before they are transported to their destination.

Thus, the correct option is D.

For more details regarding Golgi bodies, visit:

https://brainly.com/question/13274076

#SPJ2

What does a targeted digestive capsule mean?

Answers

Targeted to help just that the (digestive system) a digestive capsule is a coated tablet that is digested

What kind of mineral ID is this?

please hurry !! thank you :)

Answers

Answer:

Cleavage and Fracture

Explanation:

Cleavage is the way a mineral breaks. Many minerals break along flat planes, or cleavages—some in only one direction (like mica), others in two directions (like feldspar), and some in three directions (like calcite) or more (like fluorite). Some minerals, like quartz, have no cleavage. Cleavage is a profound property that results from a mineral's molecular structure, and cleavage is present even when the mineral doesn't form good crystals. Cleavage can also be described as perfect, good or poor.

Medium required for activity of pancreatic enzymes is

Answers

Answer:

Pancreatic juice requires alkaline medium for their action. The reason of its alkalinity is due to the presence of bicarbonate ions. Bicarbonates are used to neutralize the acidic gastric acid.

organisms that have many characteristics in common are grouped into a _______?

Answers

Organisms that have many characteristics in common are grouped into a ’species’ - hope this helped :)

Answer:

The are grouped in species...

1. What makes water so unique?

Answers

Answer:

It is the reason the sky is blue

Explanation:

water helps you live, literally.

what is a scientific question

Answers

A question that is based on observations and that is testable

Explanation:

dictionary

Answer: a question that is based on observations and that is testable

Explanation: Hope this helps :)

Describe a non-biological hierarchy that exists in everyday life and how it relates to a biological system.


Answers

Answer:

A non-biological hierarchy could be the way the military is organized, with the soldiers at the very bottom and the big commanders on top. (I don't know the specific names for each of them) This relates to a biological heirarchy since the smaller, sadly less important things are at the bottom, like atoms and soldiers, and each group of soldiers makes a regiment (which would be a molecule), then a battalion (which would be a cell), then so on. (I dont know the order of the groups but you can look it up)

Are fungi Producers or Consumers?

Answers

Answer:

Bacteria and fungi are actually decomposers. They eat decaying matter - dead plants and animals and in the process they break them down and decompose them.

Fungi it’s a decomposer because it decomposes the bodies of dead plants and animals.

Kayla’s family has a history of high blood pressure. High blood pressure can lead to serious health problems such as heart disease. Which statement best explains why Kayla can avoid getting heart disease?

A. Genotypes that are related to high blood pressure are not inherited.
B. Phenotypes that are related to high blood pressure are not inherited.
C. The genotype of high blood pressure can be changed.
D. The phenotype of high blood pressure can be change.

Answers

Genotypes=genetic makeup
Phenotypes= physical characteristics
You can not change your genetics, so that means C is out!
Said genotypes are usually inherited as well so A is out.
I’m not 100% sure but i would deduce the answer is B

NEED HELP ASAP!!!!

In trying to prove continental drift, Alfred Wegener used evidence from long ago to show that in the distant past, similar animal species lived in places that are ______today. For example, fossils of the________ were found in India, Africa, and Antarctica.

Answers

Wegener used Gondwana glaciation evidence, lithological and structural evidence, plates fitting together, and paleontological evidence to prove his theory. 1) separated 2)  Lystrosaurus.

What evidence used Wegener to prove his theory?

Since Wegener’s theory about continental drift was seriously criticized, he used a list of 10 pieces of evidence proposed by the geologist Du Toit that supported his theory.

The list includes Gondwana glaciation evidence, lithological and structural evidence, plates fitting together, and paleontological evidence.

Among the paleontological evidence, plant and animal fossils from the same species were found in currently separated continents. This distribution suggests the existence of a big unique supercontinent where these species used to inhabit.

For instance,

Glossopteris (fern) impressions are widely distributed in determined areas of Africa, South America, India, and Australia.

Terrestrial vertebrate fossils also support the theory. The presence of Triassic tetrapods in all continents suggests terrestrial corridors between landmasses.

Lystrosaurus ⇒ Triassic reptile ⇒ Found in Africa, India, and Antarctica

⇒ Mesosaurus ⇒ Triassic reptile ⇒ Found in South America and Africa

⇒ Cygnonathus ⇒ Triassic reptile ⇒ Found in South America and Africa

Finding these fossils on current different continents suggests that these landmasses were once together, and these species used to live in the same region.

With time, continents diverged and got separated by the ocean. The region where these species used to live got divided and fossils got separated.

In trying to prove continental drift, Alfred Wegener used evidence from long ago to show that in the distant past, similar animal species lived in places that are _separated_today. For example, fossils of the_Lystrosaurus_ were found in India, Africa, and Antarctica.

1) Separated

2) Lystrosaurus

You can learn more about Wegener evidences at

https://brainly.com/question/839947

https://brainly.com/question/9444622

#SPJ1

3. Write the complimentary sequence of DNA for the following strand:
5'-AATTAGGAGCCCAGCTTTGCCGA-3'

Answers

The correct answer is TTAATCCTCGGGTCGAAACGGCT

This is because whenever you’re trying to find the complementary sequence of DNA, you basically switch which the listed base and it’s correspondent.

Adenine -> Thymine
Cytosine -> Guanine

Hope this helps!! :)

This is a timeline depicting the development of atomic ___________. What word should be used to fill in the blank? Support your choice with evidence. A) Law. At each interval on the timeline, scientists described the patterns they saw in both atomic and subatomic structure. Eliminate B) Law. Scientists used observation, experimentation, and mathematical models to explain atomic stricter and the behavior of subatomic particles. C) Hypothesis. Scientists conducted experiments at each interval. They made educated guesses regarding atomic structure and then experimented to support or rejected the hypotheses. D) Theory. At each interval on the timeline, scientists made observations and conducted experiments to explain how atoms and/or subatomic particles behaved in order to determine atomic structure.

Answers

Answer:

Subatomic particle, also called elementary particle, any of various self-contained units of matter or energy that are the fundamental constituents of all matter. Subatomic particles include electrons, the negatively charged, almost massless particles that nevertheless account for most of the size of the atom, and they include the heavier building blocks of the small but very dense nucleus of the atom, the positively charged protons and the electrically neutral neutrons. But these basic atomic components are by no means the only known subatomic particles. Protons and neutrons, for instance, are themselves made up of elementary particles called quarks, and the electron is only one member of a class of elementary

Explanation:

because it is

it's d lol

Theory. At each interval on the timeline, scientists made observations and conducted experiments to explain how atoms and/or subatomic particles behaved in order to determine atomic structure. Let's take one example: Rutherford's gold foil experiment. Based on observing the behavior of alpha particles directed at a gold foil screen, Rutherford determined that an atom consisted of mostly empty space, with all of its positive charge concentrated in its center in a very tiny volume, surrounded by a cloud of electrons. Yet, further experimentation eventually lead to another model and another theory of atomic structure.

Accuracy is a measure of how close a value is to its true value. You can control accuracy by choosing the appropriate tool or instrument and using it carefully. How could the students in the following questions improve their accuracy? Tyrrell wanted to measure the growth of tomato plants in response to different types of fertilizer. Which tool would be most accurate?

Answers

Answer:Metric ruler

Explanation:

Answer:

1. Metric ruler

2. a pH meter can distinguish smaller differences in pH as compared to a pH strip.

Explanation:

Got those right on edge ;)

why did europeans want to conquer the new world ?

Answers

Answer:

Europeans wanted to explore the world so that they could gain wealth. European rulers fought many wars and they were very expensive so they needed to find gold, silver and precious stones to pay for them.

Explanation:

Which of the following most likely causes the rate of a chemical reaction to increase? (5 points) Decreasing the reaction temperature Slowing down the reacting molecules Taking away heat from the reaction Adding heat to the reaction

Answers

Answer:

Adding heat to the reaction

Explanation:

heat increases the kinetic energy of the reacting molecules thereby increasing the rate of reaction.

Answer:

D.adding heat to the reaction

Explanation:

i got it right on the quiz

I will give brainliest!!!

You're looking through a microscope at a eukaryotic cell and notice that its genetic material (DNA) is openly floating around the cytosol.

What could be a possible cause for what you're seeing through the microscope?

Choose 1 answer:

(Choice A)
A
The lysosome is damaged.

(Choice B)
B
The nucleus is damaged.

(Choice C)
C
The vacuole is damaged.

(Choice D)
D
There is no cause; genetic material should be floating around the cell in this manner.

Answers

Answer:

B. The nucleus is damaged.

Explanation:

Eukaryotic cells contain a membrane-bound nucleus and numerous membrane-enclosed organelles. DNA is present in the nucleus of the cell. If the nuclear membrane is ruptured/damaged then the nucleoplasm along with the DNA will openly float around the cytosol.

Answer: The nucleus is damaged.

Explanation: The nucleus is supposed to keep genetic material (DNA) housed within its membrane-bound structure, but in this cell, the genetic material is openly floating around the cell's cytosol. Have a nice day :)

What process maintains a stable internal condition, despite changes in the external environment?

A) Metabolism
B) Reproduction
C) Respiration
D) Homeostasis

Answers

Answer:Homeostasis

AP Biology

Answer:

D

Explanation:

Why is it beneficial for the earth to have both autotrophic and hypertrophic?

Answers

Because it will create balance on the earth. For example if there are only autotrophs there will be competition for nutritious and space for the roots to grow .Also for the heterotrophs, the harbivous will be hard for them to find plants to eats eventually it will lead to starvation then death and their death will affect carnivores because the organisms that they used to hunt are all dead now. So when there is a balance between autotrophs and heterotrophs they will help each other to survive.

SCIENCE- help me please I have to turn this in tonight PLEASE.............

Answers

Answer:

Yes,if it has a large mass it will have a large weight Awnser (2)

Which statements are true about "evidence"?
1.observations which answer questions
2.proof that an idea is true
3.data to help draw a conclusion
4.information for or against an idea

Answers

Answer;

2. proof that an idea is true

Explanation:

Plsss helppp plllsss helppp

Answers

Answer:

A

Explanation:

A solution with a pH lower that 7.0 is acidic, so that narrows the answers down to a and d. OH- is a base and H+ is acidic, so the answer is A

Answer:

I cant really read it, its kinda blurry.

Explanation:

Other Questions
6. DE with endpoints D(-3, -4) and E(4, 2) under the translation(x, y) + (x + 1, y + 3) If you wanted to find your exact location,which new technology in geography could use a system of satellite signals and receivers to help you? What is polarization? Is it nearly impossible to prove ownership of intellectual property Both the Shang Dynasty and the Xia Dynasty were located along which river? FREE BRAINLY AND 100 POINTS!! Which actions best demonstrated Theodore Roosevelts beliefs toward the natural environment? He reduced regulations on factories and construction to better allow the usage of resources. He worked with naturalists in protecting wilderness by setting up area for conservation. He supported the Pure Food and Drug Act which led to the formation of the Food and Drug Administration. He supported mining interests in areas such as Crater Lake in Oregon. A town has a population of 4000 and grows at 2% every year. To the nearest year, how long will it be until the population will reach 6400? A web page designer creates an animation in which a dot on a computer screen has a position of r =[ 4.50 cm +( 2.90 cm/s2 )t2]i^+( 4.70 cm/s )tj^ . Part A Find the average velocity of the dot between t=0 and t=2.0s. Give your answer as a pair of components separated by a comma. For example, if you think the x component is 3 and the y component is 4, then you should enter 3,4. . Rohith purchased a book for Rs.573.75 and a pen for Rs.25.50. His fathergave him a Rs 1000 note. How much money is left with him afterpurchasing both the things? In many countries, citizens are required to serve in the military for a year or more. Do you believe the United States should institute a similar practice? Why or why not? Use specific reasons and examples to support your answer. Group of answer choices The Inuit tribe belonged to which region? Predict: Will a 1500 kg car moving at the same speed as the tennis ball have more momentum or less? (i think more)Calculate the momentum of the car and record it here. By selling 75 apples, a seller gains the cost price of 15 apples. find his gain percentage? please help me, and be quick Texas is the #1 producer in the United States of all the following except Why was slavery such an important institution for the South? What compound is this? Carbohydrates LipidsNucleic acidsProteins How do you do number 15? Is myosin a fibrous protein or a globular protein? There are 5.2 x 10^5 words in the English dictionary. What is the average number of words recorded under each of the 26 letters? Give your answer in scientific notation.