you can approximate e by substituting large values for n into what expression

Answers

Answer 1

This method of approximation is derived from the mathematical concept of limits and the definition of the number e as the limit of (1 + 1/n)^n as n approaches infinity. By increasing the value of n, we approach closer and closer to the actual value of e.

To approximate the mathematical constant "e," you can use the expression (1 + 1/n)^n, where n is a large value. As n approaches infinity, this expression converges to the value of e. The larger the value of n, the closer the approximation will be to the actual value of e.

For example, let's substitute a large value, say n = 10,000, into the expression:

Approximation of e ≈ (1 + 1/10,000)^10,000

Calculating this expression, we get an approximation of e as approximately 2.7181459. Although it's not an exact value, it is a close approximation of the mathematical constant.

To use this approximation, choose a large value for "n", such as 10,000 or 100,000, and evaluate the expression (1 + 1/n)^n using a calculator or computer program. The result will be a close approximation of the value of "e". The larger the value of "n", the more accurate the approximation will be.

For more such questions on Infinity:

https://brainly.com/question/31122071

#SPJ8


Related Questions

what is the probability that a data value in a normal distribution is between a z-score of 1.65 and a z-score of 2.24? Round your answer to the nearest tenth of a percent.

Answers

The probability that a data value in a normal distribution is between a z-score of 1.65 and a z-score of 2.24 is approximately 6.9%.

To calculate the probability, we need to use the standard normal distribution table or a statistical calculator.

Look up the cumulative probability for the lower z-score (1.65):

From the standard normal distribution table or a statistical calculator, we find that the cumulative probability for a z-score of 1.65 is approximately 0.9505.

Look up the cumulative probability for the higher z-score (2.24):

Similarly, the cumulative probability for a z-score of 2.24 is approximately 0.9875.

Calculate the probability between the two z-scores:

To find the probability between the two z-scores, we subtract the cumulative probability of the lower z-score from the cumulative probability of the higher z-score.

Probability = Cumulative probability (Higher z-score) - Cumulative probability (Lower z-score)

Probability = 0.9875 - 0.9505

Probability = 0.037

Convert the probability to a percentage:

Multiply the probability by 100 to express it as a percentage.

Probability (in percentage) = 0.037 × 100

Probability (in percentage) = 3.7%

Rounded to the nearest tenth of a percent, the probability that a data value in a normal distribution is between a z-score of 1.65 and a z-score of 2.24 is approximately 6.9%.

For more such questions on probability, click on:

https://brainly.com/question/13604758

#SPJ8

Polygon ABCD with vertices at A(−4, 6), B(−2, 2), C(4, −2), and D(4, 4) is dilated using a scale factor of four fifths to create polygon A′B′C′D′. If the dilation is centered at the origin, determine the vertices of polygon A′B′C′D′.

A′(−3.2, 4.8), B′(−1.6, 1.6), C′(3.2, −1.6), D′(3.2, 3.2)
A′(−16, 24), B′(−8, 8), C′(16, −24), D′(16, 16)
A′(3.2, −4.8), B′(1.6, −1.6), C′(−3.2, 1.6), D′(−3.2, −3.2)
A′(4.5, −3), B′(1.5, −1.5), C′(−1.5, 3), D′(3, 3)

Answers

Answer:

A.

Step-by-step explanation:

New x-coordinate = (-4) * (4/5) = -16/5 = -3.2

New y-coordinate = 6 * (4/5) = 24/5 = 4.8

that's the only option with a -3.2 for A

a die is thrown once. what is the probability that the score is a factor of 6

Answers

Answer:

6 by 36 is the answer.....

What is 8x6 explain

Answers

8 x 6 is 48.

8 x 6 can also be written as eight 6s or six 8s.

So 8 + 8 + 8 + 8 + 8 + 8 or 6 + 6 + 6 + 6 + 6 + 6 + 6 + 6.

simplify 1/2 of 1/4 ÷1/3_1/4-3/4+1\2

Answers

Simplifying the given expression results to

-3/8

How to simplify the expression

To simplify the expression using PEMDAS (Parentheses, Exponents, Multiplication and Division from left to right, and Addition and Subtraction from left to right), we'll break it down step by step:

The expression is rewritten as, 1/2 (1/4 ÷ 1/3 - 1/4 - 3/4 + 1/2). hence we start we parenthesis.

Performing division results to

1/2 (3/4 - 1/4 - 3/4 + 1/2)

Performing addition results to

1/2 (3/4 - 1/4 - 5/4)

Performing subtraction results to

1/2 (-3/4)

Now we multiply

-3/8

Learn more about PEMDAS at

https://brainly.com/question/11421179

#SPJ1

[tex] \frac{x}{n} + 2 = w[/tex]
make x the subject​

Answers

The variable x as the subject​ of the equation is x = n(w - 2)

How to make x the subject​ of the equation

From the question, we have the following parameters that can be used in our computation:

x/n + 2 = w

Subtract 2 frm both sides of the equation

So, we have

x/n = w - 2

Next, we have

x = n(w - 2)

Hence, the solution is x = n(w - 2)

Read more about equation at

https://brainly.com/question/32583193

#SPJ1

The midpoint of AB is M(-1,0). If the coordinates of A are (6,-4), what are the coordinates of B?

Answers

Answer:

B(-8, 4)

Step-by-step explanation:

To find the coordinates of B, use the midpoint formula.

[tex]\boxed{\begin{minipage}{7.4 cm}\underline{Midpoint between two points}\\\\$M=\left(\dfrac{x_2+x_1}{2},\dfrac{y_2+y_1}{2}\right)$\\\\\\where:\\\phantom{ww}$\bullet$ $M$ is the midpoint.\\\phantom{ww}$\bullet$ $(x_1,y_1)$ and $(x_2,y_2)$ are the endpoints.\\\end{minipage}}[/tex]

Let point A be (x₁, y₁). Therefore, (x₁, y₁) = (6, -4).

Let point B be (x₂, y₂).

The midpoint M is (-1, 0).

Substitute these values into the midpoint formula:

[tex](-1, 0)=\left(\dfrac{x_2+6}{2},\dfrac{y_2-4}{2}\right)[/tex]

Solve the x and y coordinates separately:

[tex]\begin{aligned}\dfrac{x_2+6}{2}&=-1\\\\x_2+6&=-2\\\\x_2&=-8\end{aligned}[/tex]                              [tex]\begin{aligned}\dfrac{y_2-4}{2}&=0\\\\y_2-4&=0\\\\y_2&=4\end{aligned}[/tex]

Therefore, the coordinates of point B are (-8, 4).

Part D
Assuming that any increase occurs in whole dollar amounts, what is the maximum possible increase that maintains
the desired minimum revenue? Explain why this is true.

Answers

The desired minimum revenue is $3. See the reason below.

What is the reason why the above is true?

Charge= b, Customer= c, Revenue= r

r= bc, currently, r= 16*10= $160

We know that: b+1 ⇒ c-2  and the target is r ≥ 130

So, this will all be reflected as -

b=10+x ⇒ c= 16-2x

(10+x)(16-2x) ≥ 130

160 -20x +16x - 2x² ≥ 130

-2x² - 4x + 30 ≥ 0

x² + 2x -15 ≤ 0

(x+1)² ≤ 4²

x+1 ≤ 4 (negative value not considered)

x ≤ 3

As we see the max increase amount is $3, when the revenue will be  -

(10+3)*(16-3*2)= 13*10= $130

Learn more about revenue at:

https://brainly.com/question/29786149

#SPJ1

Full Question:

Although part of your question is missing, you might be referring to this full question:

Noah manages a buffet at a local restaurant. He charges $10 for the buffet. On average, 16 customers choose the buffet as their meal every hour. After surveying several customers, Noah has determined that for every $1 increase in the cost of the buffet, the average number of customers who select the buffet will decrease by 2 per hour. The restaurant owner wants the buffet to maintain a minimum revenue of $130 per hour. Noah wants to model this situation with an inequality and use the model to help him make the best pricing decisions. Assuming that any increase occurs in whole dollar amounts, what is the maximum possible increase that maintains the desired minimum revenue? Explain why this is true.

Alan solved the proportion StartFraction x over 200 EndFraction = StartFraction 8 over 25 EndFraction as shown.

StartFraction x over 200 EndFraction = StartFraction 8 over 25 EndFraction. (8) (x) = (25) (200). 8 x = 5,000. StartFraction 8 x over 8 EndFraction = StartFraction 5,000 over 8 EndFraction. X = 625.

What is Alan’s error?
He got the wrong product when he multiplied 25 by 200.
He got the wrong quotient when he divided 5,000 by 8.
He mixed up the positions of 8 and 25 in the equation (8) (x) = (25) (200).
He mixed up the positions of 8 and 200 in the equation (8) (x) = (25) (200).

Answers

The correct answer is that Alan mixed up the positions of 8 and 25 in the equation (8)(x) = (25)(200). This mistake led to incorrect calculations and the wrong answer.

Alan's error lies in mixing up the positions of 8 and 25 in the equation (8)(x) = (25)(200). In the original proportion, the correct equation is (x/200) = (8/25).

However, Alan mistakenly wrote it as (8)(x) = (25)(200), reversing the positions of 8 and 25. This error leads to incorrect calculations and ultimately an incorrect answer of x = 625.

Let's break down Alan's steps to understand his mistake:

StartFraction x over 200 EndFraction = StartFraction 8 over 25 EndFraction.

Alan correctly writes down the proportion.

(8)(x) = (25)(200).

Here is where Alan's error occurs. Instead of multiplying 8 by x and 25 by 200, he mistakenly swaps their positions. This mistake results in incorrect products.

8x = 5,000.

Alan multiplies incorrectly and obtains 5,000 as the product of 25 and 200.

StartFraction 8x over 8 EndFraction = StartFraction 5,000 over 8 EndFraction.

Alan divides both sides of the equation by 8, which is the correct step.

x = 625.

Alan divides 5,000 by 8 to find the value of x, which is his final incorrect answer. So, the correct option is he mixed up the positions of 8 and 25 in the equation (8) (x) = (25) (200).

For more such questions on equation

https://brainly.com/question/29797709

#SPJ8

A weight is attached to a spring and reaches its equilibrium position ​(x​=0). It is then set in motion resulting in a displacement of ​x=12 cos t, where x is measured in centimeters and t is measured in seconds. See the figure shown to the right. Answer parts ​(a) and ​(b).

Answers

a. The spring's displacement when t = 0 is 12 cm.

The spring's displacement when t = π/3 is 6 cm.

The spring's displacement when t= 3π/4 is -6√2 cm.

b. The spring's velocity when t = 0 is 0 cm/sec.

The spring's velocity when t = π/3 is -6√3 cm/sec

The spring's velocity when t= 3π/4 is -6√2 cm/sec.

How to determine the spring's displacement?

a. When t = 0, the spring's displacement can be calculated by using the given displacement equation:

x = 12cost

x(0) = 12cos(0)

x(0) = 12 cm.

When t = π/3, the spring's displacement can be calculated by using the given displacement equation:

x = 12cost

x(π/3) = 12cos(π/3)

x(π/3) = 12 × 1/2 = 6 cm.

When t = 3π/4, the spring's displacement can be calculated by using the given displacement equation:

x = 12cost

x(3π/4) = 12cos(3π/4)

x(3π/4) = 12 × -√2/2 = -6√2 cm.

Part b.

In order to determine the spring's velocity, we would have to take the first derivative of the displacement equation with respect to time;

v(t) = dx/dt = -12sint

When t = 0, the spring's velocity can be calculated as follows:

v(0) = -12sin(0)

v(0) = 0 cm/sec.

When t = π/3, the spring's velocity can be calculated as follows:

v(π/3) = -12sin(π/3)

v(π/3) = -6√3 cm/sec.

When t = 3π/4, the spring's velocity can be calculated as follows:

v(3π/4) = -12sin(3π/4)

v(3π/4) = -6√2 cm/sec.

Read more on spring's velocity here: https://brainly.com/question/33115101

#SPJ1

Missing information:

The question is incomplete and the complete question is shown in the attached picture.

Help me pleaseeee. It my math hw you don’t have to do all of them at least do 4 please

Answers

Answer:

#5 - [tex]x=-2[/tex]

#6 - [tex]x=-4[/tex]

#7 - [tex]x=2[/tex]

#8 - [tex]x=10[/tex]

Step-by-step explanation:

Solve the following multi-step equations.

#5 - [tex]-10-7x=-3x-2[/tex]

#6 - [tex]-13-4x=x+7[/tex]

#7 - [tex]x-2=10-5x[/tex]

#8 - [tex]3x-1=4x-11[/tex]

[tex]\hrulefill[/tex]

I will use the SCAM method to solve these multi-step equations.

[tex]\mathbb{S}\text{implify each side of the equation} \\\\\\\mathbb{C}\text{ombine like terms, collect variables on one side }\\\\\\\mathbb{A}\text{dd and/or subtract}\\\\\\\mathbb{M}\text{ultiply and/or divide}[/tex]

What is our goal when solving equations?

Our goal is to isolate the variable.

Remember when solving equations, whatever you do to one side of the equation you must do to the other.  [tex]\hrulefill[/tex]

Now solving #5,

[tex]-10-7x=-3x-2[/tex]

Observing the equation, we notice on either side of the equation we cannot simplify using the distributive property or order of operations ("PEMDAS"). Well will skip to the "C" in SCAM.

Add "7x" to each side of the equation.

[tex]\Longrightarrow -10-7x+7x=-3x-2+7x\\\\\\\Longrightarrow -10=4x-2[/tex]

The variable "x" now appears on one side of the equation. Now we are on the "A" in SCAM.

Add the value of "2" to each side of the equation.

[tex]\Longrightarrow -10+2=4x-2+2\\\\\\\Longrightarrow -8=4x[/tex]

Now on the "M" in SCAM.

Divide both sides of the equation by the value of "4."

[tex]\Longrightarrow \dfrac{-8}{4}=\dfrac{4}{4}x\\\\\\\Longrightarrow -2=x\\\\\\\therefore \boxed{x=-2}[/tex]

Thus, problem #5 is solved.

[tex]\hrulefill[/tex]

For the rest of the problems I will simply show the operations I am doing.

Now solving #6,

[tex]-13-4x=x+7\\\\\\\Longrightarrow -13-4x+4x=x+7+4x\\\\\\\Longrightarrow -13=5x+7\\\\\\\Longrightarrow -13-7=5x+7-7\\\\\\\Longrightarrow -20=5x\\\\\\\Longrightarrow \dfrac{-20}{5}= \dfrac{5}{5}x\\\\\\\Longrightarrow-4=x\\\\\\\therefore \boxed{x=-4}[/tex]

Thus, problem #6 is solved.

[tex]\hrulefill[/tex]

Now solving #7,

[tex]x-2=10-5x\\\\\\\Longrightarrow x-2+5x=10-5x+5x\\\\\\\Longrightarrow 6x-2=10\\\\\\\Longrightarrow 6x-2+2=10+2\\\\\\\Longrightarrow 6x=12\\\\\\\Longrightarrow \dfrac{6}{6}x=\dfrac{12}{6}\\\\\\\therefore \boxed{x=2}[/tex]

Thus, problem #7 is solved.

[tex]\hrulefill[/tex]

Now solving #8,

[tex]3x-1=4x-11\\\\\\\Longrightarrow 3x-1-3x=4x-11-3x\\\\\\\Longrightarrow -1=x-11\\\\\\\Longrightarrow -1+11=x-11+11\\\\\\\Longrightarrow 10=x\\\\\\\therefore \boxed{x=10}[/tex]

Find the value of z such that 0.516 of the area lies between -z and z

Answers

The value of z such that 0.516 of the area lies between -z and z is approximately 0.05.

To find the value of z such that 0.516 of the area lies between -z and z, we can use the standard normal distribution table or a statistical calculator.

First, we need to find the area under the standard normal curve that lies between -z and z.

Since the standard normal distribution is symmetric, we can find the area to the right of z and then double it to account for both tails.

From the given information, we know that the total area between -z and z is 0.516.

Since the standard normal distribution is standardized with a mean of 0 and a standard deviation of 1, we can use the standard normal distribution table to find the corresponding z-value.

Using the standard normal distribution table, we can look up the area of 0.516.

Looking at the table, we find that the closest area is 0.5149, corresponding to a z-value of approximately 0.05.

Since the standard normal distribution is symmetric, the area to the left of -0.05 is also 0.5149.

Therefore, the z-value that corresponds to an area of 0.516 lies between -0.05 and 0.05.

For similar question on area.

https://brainly.com/question/25292087  

#SPJ8

Segments AC and BD are diameters of Circle E. If arc ACD = 326 then what does arc CDB equal?

Answers

Answer:

Since segments AC and BD are diameters of Circle E, angle ACD is a central angle that intercepts arc ACD, and angle BCD is also a central angle that intercepts arc ACD. Therefore, arc ACD is divided into two equal arcs, arc CDB and arc CAB, by the diameter CD.

Since arc ACD is 326 degrees, each of arc CDB and arc CAB is 326/2 = 163 degrees.

Therefore, arc CDB equals 163 degrees.

Jose wakes up ealry if and only if he is going for a bike ride what is the contrapositive

Answers

The contrapositive of the sentence is this: Jose isn't going for a bike ride if and only if he doesn't wake up early.

What is a contrapositive?

A contrapositive is a statement that challenges both the predicate and the subject of a given sentence. In the above sentence, the statement is that Jose wakes up early if and only if he is going for a bike ride.

The contrapositive now challenges the subject's action of waking up early and going for a bike ride. The hypothesis and conclusion are disputed.

Learn more about the contrapositive here:

https://brainly.com/question/30045217

#SPJ1

Which expression is equivalent to (f g) (5)?
f (5) times g (5)
f (5) + g (5)
5 f (5)
5 g (5)

Answers

The expression that is equivalent to the composite function (f ° g) (5) is; Option A: f (5) times g (5)

How to solve composite functions?

A composite function is defined as an operation where two functions say f and g, generate a new function say h in such a way that h(x) = g(f(x)). It means here that function g is said to be applied to the function of x. So, this basically,l tells us that a function is applied to the result of another function.

We want to find (f ° g) (5)

This simply means f(5) × g(5)

The composite function definition demands that must be the expression of the the question and as such option A is the only correct option.

Read more about composite functions at;

https://brainly.com/question/10687170

#SPJ1

Answer:

f(5) x g(5)

Step-by-step explanation:

(fg)(5) = (f x g)(5) = f(5) x g(5)

What is the simplified form of the expression (-3x^2 + x + 5) − (4x^2 − 2x)

Answers

The simplified form of the expression (-3x² + x + 5) - (4x² - 2x) is -7x² + 3x + 5.

To simplify the expression (-3x² + x + 5) - (4x² - 2x)

you will have to perform the subtraction of the two polynomials.

This can be done by first removing the brackets by applying the negative sign of the second polynomial.

After removing the brackets, you can combine like terms.

Hence;

(-3x² + x + 5) - (4x² - 2x)

= -3x²+ x + 5 - 4x²+ 2x (applying negative sign)

= -3x² - 4x² + x + 2x + 5 (combining like terms)

= -7x² + 3x + 5

Therefore, the simplified form of the  given expression is -7x² + 3x + 5.

For more such questions on expression visit:

https://brainly.com/question/1859113

#SPJ8

please help find g(12)

Answers

Answer:

g(12) = 10

Step-by-step explanation:

To find g(12)

here t = 12 and lies in the range 6 ≤ t ≤ 12

so we use g(t) = [tex]\frac{5t}{6}[/tex]

⇒ g(12) = [tex]\frac{5*12}{6}[/tex]

= 5*2

= 10

g(12) = 10

A town's population has been growing linearly. In 2003 the population was 28,000. The population has been growing by 1200 people each year.

Write an equation for the population, P, years after 2003.

Answers

The population increases by 1200 people each year starting from the base population of 28,000 in 2003.

To write an equation for the population, P, years after 2003, we can use the information given about the population growth.

We know that in 2003, the population was 28,000. Since the population has been growing linearly by 1200 people each year, we can express the growth rate as 1200 people per year.

Let's denote the number of years after 2003 as 'x'. Since the growth rate is constant, we can use the slope-intercept form of a linear equation to represent the population:

P = mx + b

Where:

P represents the population

m represents the slope (growth rate)

x represents the number of years after 2003

b represents the y-intercept (population in the base year)

In this case, the slope, m, is 1200 people per year, and the y-intercept, b, is 28,000 people in 2003.

Plugging in the values, the equation for the population, P, years after 2003 becomes:

P = 1200x + 28000

This equation represents the linear growth of the town's population, where the population increases by 1200 people each year starting from the base population of 28,000 in 2003.

For more questions on population .

https://brainly.com/question/30412211

#SPJ8

Geometry
Answer fast

Answers

Answer:

Your correct

Step-by-step explanation:

The transversal,a, creates right angles for line b, c, and d. This they are parallel

What is 8.7x0.45 if you multiply it

Answers

The solution to the multiplication of the decimals is; 39.15

How to multiply decimals?

One of the ways to multiply decimals is as follows;

To multiply decimals, first multiply as if there is no decimal.

Second step is to count the number of digits after the decimal in each factor.

Last step is to put the same number of digits behind the decimal in the product.

Now, we want to multiply the decimals given as;

8.7 × 0.45

Converting them to fractions gives us;

(87/10) × (45/10)

= 3915/100

= 39.15

Thus, that is the solution to the multiplication of the decimals.

Read more about multiplying decimals at; https://brainly.com/question/28338004

#SPJ1

What positive value of b makes this equation true
Leave your answer in radical form.
9 to the power of 2 b to the power of 2 = 12 to the power of 2

Answers

Answer:

[tex]\huge\boxed{\sf b = 4/3}[/tex]

Step-by-step explanation:

Given equation:

[tex]9^2 \times b^2 = 12^2[/tex]

So,

81 × b² = 144

Divide both sides by 81

b² = 144 / 81

b² = (12 × 12) / (9 × 9)

b² = 12² / 9²

Take square root on both sides

√b² = √(12²/9²)

b = 12 / 9

b = 4 / 3

[tex]\rule[225]{225}{2}[/tex]

This is the input-output table for the linear function y = 3x. Table_XY Which best describes how the y-values are increasing over each interval? Subtract 10 over each interval. Multiply by 2 over each interval. Add 3 over each interval..

Answers

Step-by-step explanation:

Can you provide an image please?

Answer:

C

Step-by-step explanation:

The figure below is a net for a right rectangular prism.
7 cm
7 cm
10 cm
10 cm
13 cm
10 cm
10 cm

Answers

A net is a two-dimensional pattern that can be folded into a three-dimensional shape. The figure you provided is a net for a right rectangular prism with dimensions 10 cm x 7 cm x 13 cm. It consists of six rectangles, where the two rectangles on the ends have dimensions of 10 cm x 7 cm, and the four rectangles in the middle have dimensions of 13 cm x 7 cm.

To create the right rectangular prism from the net, you would need to cut along the solid lines and fold along the dashed lines. The two rectangles with dimensions 10 cm x 7 cm would become the top and bottom faces of the prism, while the four rectangles with dimensions 13 cm x 7 cm would become the four side faces of the prism. When folded and glued or taped together, the prism would have a height of 10 cm, a width of 7 cm, and a length of 13 cm.

Using Company A's calling plan, the cost of an overseas phone call is a $0.85 connection fee plus 28 cents per minute. If the total cost of the call is $14.85, how long is the phone call?​

Answers

Answer:

50 minutes

Step-by-step explanation:

28 cents = $0.28

Let the call be for x minutes

Total cost = connection fee + x*cost per minute

14.85 = 0.85 + 0.28x

14.85 - 0.85 = 0.28x

0.28x =  14

x = 14/0.28

x = 50

Answer:

50 min

Step-by-step explanation:

Let the call be for x minutes

14.85 = 0.85 + 0.28x

0.28x = 14

x = 14/0.28 = 50

The advisor of a school club wants to select 4 of its 25 members to raise and lower the flag each day this week. She assigns a two-digit number from 01 to 25 to each student. What are the numbers that correspond to the members who will raise and lower the flag? Use the random number table below.
97836 74547 79986 58820 36071 17996 59066 36220 46340 66069 51761 41740 39326 52760
The numbers that correspond to the students are (Use a comma to separate answers as needed.)​

Answers

The numbers that correspond to the members who will raise and lower the flag are 97836, 74547, 79986, and 58820.

To select 4 members from a group of 25, we can use the random number table provided to assign numbers to each student and choose the corresponding numbers to identify the members who will raise and lower the flag. Let's go through the process step by step:

Step 1: Assign a two-digit number from 01 to 25 to each student.

We have 25 students, so we can assign each student a number from 01 to 25. Let's match the given numbers with the students:

97836 - Student 1

74547 - Student 2

79986 - Student 3

58820 - Student 4

36071 - Student 5

17996 - Student 6

59066 - Student 7

36220 - Student 8

46340 - Student 9

66069 - Student 10

51761 - Student 11

41740 - Student 12

39326 - Student 13

52760 - Student 14

Note: The remaining students from 15 to 25 are not provided in the given random number table, so we cannot assign numbers to them based on the given information.

Step 2: Choose the corresponding numbers to identify the members who will raise and lower the flag.

Since we need 4 members, we can select any four numbers from the given list that correspond to the assigned numbers of the students. Let's say we choose the first four numbers:

97836 - Student 1 (Will raise and lower the flag)

74547 - Student 2 (Will raise and lower the flag)

79986 - Student 3 (Will raise and lower the flag)

58820 - Student 4 (Will raise and lower the flag)

For more such questions on numbers visit:

https://brainly.com/question/24644930

#SPJ8

please awnser ASAP i will brainlist

Answers

The second coordinate of the given first coordinate is determined as;

f(0) = 1

(1) = 6.06.

What is the second coordinate of the given coordinate?

The second coordinate of the given first coordinate is calculated by applying the following method as follows;

The given function;

F(x) = [tex]4^{1.3x}[/tex]

The value of f(0) is calculated as;

f (0) = [tex]4^{1.3 \times 0}[/tex] = 4⁰ = 1

The value of f(1) is calculated as;.

f (1) = [tex]4^{1.3 \times 1} = 4^{1.3}[/tex] = 6.06

Thus, the second coordinate of the given first coordinate is determined by applying the appropriate substittue of the function as shown above.

Learn more about second coordinate here: https://brainly.com/question/31378416

#SPJ1

How many 9/4 hours are there in 3/4 hour?

1/3
3
1/4
4

Answers

Answer: 1/4

Step-by-step explanation:

What would the points be?

Answers

The points in the graph of the system of inequalities are:

(-2, 0) --> not a solution.

(5, 0) --> not a solution.

(7, 0) --> not a solution.

(0, 7) --> solution.

What would the points be?

Here we can see the graph of a system of inequalities, and there we have the points:

(-2, 0)

(5, 0)

(7, 0)

(0, 7)

You can see that all the points lie on the lines (these are solid lines, meaning that the points on the lines are solutions for the corresponding inequality)

Now, a point is a solution of a system of inequalities only if it solves both of them at the same time.

The only point that is a solution of both inequalities at the same time is point (0, 7).

So the points are:

(-2, 0) --> not a solution.

(5, 0) --> not a solution.

(7, 0) --> not a solution.

(0, 7) --> solution.

learn more about systems of inequaltiies at:

https://brainly.com/question/9774970

#SPJ1

Select the correct answer.

Laura is planning a party for her son. She has $50 dollars remaining in her budget and wants to provide one party favor per person to at least 10 guests. She found some miniature stuffed animals for $6.00 each and some toy trucks for $4.00 each.

Which system of inequalities represents this situation, where x is the number of stuffed animals and y is the number of toy trucks?

A.
6x + 4y ≤ 50
x + y ≤ 10
B.
6x + 4y ≤ 50
x + y ≥ 10
C.
6x + 4y ≥ 50
x + y ≤ 10
D.
6x + 4y ≥ 50
x + y ≥ 10

Answers

Answer: B. 6x + 4y ≤ 50 x + y ≥ 10

Step-by-step explanation: To represent this situation with a system of inequalities, we need to consider two constraints: the budget and the number of guests.

The budget constraint is that the total cost of the party favors should not exceed $50. Since each stuffed animal costs $6 and each toy truck costs $4, the total cost can be expressed as 6x + 4y, where x is the number of stuffed animals and y is the number of toy trucks. To satisfy the budget constraint, we need 6x + 4y to be less than or equal to 50. This gives us the first inequality: 6x + 4y ≤ 50.

The number of guests constraint is that Laura wants to provide at least one party favor per person to at least 10 guests. This means that the total number of party favors should be greater than or equal to 10. Since each party favor is either a stuffed animal or a toy truck, the total number of party favors can be expressed as x + y, where x and y are the same as before. To satisfy the number of guests constraint, we need x + y to be greater than or equal to 10. This gives us the second inequality: x + y ≥ 10.

Therefore, the system of inequalities that represents this situation is:

6x + 4y ≤ 50 x + y ≥ 10

Hope this helps, and have a great day! =)

are these functions. {(2, 3), (1, 3), (5, 3), (2, 6)}

Answers

The set of points you provided, {(2, 3), (1, 3), (5, 3), (2, 6)}, represents a collection of four points in the coordinate plane. Each point consists of an x-coordinate and a corresponding y-coordinate.

(2, 3) means that the x-coordinate is 2, and the y-coordinate is 3.
(1, 3) means that the x-coordinate is 1, and the y-coordinate is 3.
(5, 3) means that the x-coordinate is 5, and the y-coordinate is 3.
(2, 6) means that the x-coordinate is 2, and the y-coordinate is 6.

These points do not represent functions on their own, but they can be used to define a relationship between x and y values. To determine a function, we need to ensure that each x-coordinate is associated with only one y-coordinate. If any x-coordinate is associated with multiple y-coordinates, it would not represent a function.

In this case, the x-coordinate 2 is associated with both y-coordinates 3 and 6. Therefore, the set of points {(2, 3), (1, 3), (5, 3), (2, 6)} does not represent a function since the x-coordinate 2 is paired with different y-coordinates.
Other Questions
Our perception of the color of an object is determined by both the color of the object and the color of the light striking it. True False Question 43 (1 point) Saved What is responsible for the most deaths in building fires? O burns heat stroke smoke inhalation. Find the following Laplace transforms (a) L[(1e t)/t] (b) L[sinh 2t/t] (c) L[(coshtcost)/t] (d) L[sinh 2t/t 2] 2. Calculate (a)L[ 0t1e d], (b) L[t 0tsind] Write an Xcode to view the UI feature. (Use your own example)What is a hobbyist attack? help please. its worth 20 percent of my gradeeee!!! A firm with a return on common equity (ROCE) of 30% has financial leverage of 37.5% and a net after-tax borrowing cost of 5% on $240 million of net debt.i) What rate of return does this firm earn on its operations?ii) The firm is considering repurchasing $150 million of its stock and financing the repurchase with further borrowing at a 5% after-tax borrowing cost. What effect will this transaction have on the firms return on common equity if the same level of operating profitability is maintained?iii) Will this repurchase change the per-share intrinsic value of the equity? Why?iv) Will the normal P/E ratio for this firm change because of this transaction? Why?v) The firm had an unlevered price-to-book ratio (P/B) of 1.8 prior to the transaction. What will be the effect of the repurchase on the levered price-to-book ratio?vi) Would you expect the earnings-per-share growth rate to change after the repurchase transaction? Why? which best describes why it is so difficult to change the paradigm of health care from disease orientation to promoting health orientation? Larry Matt completed these transactions during December of the current year: Dec. Began a financial services practice by investing $15,000 cash and office 1 equipment having a $5,000 value. Purchased $1,200 of office equipment on credit. Purchased $300 of office supplies on credit. Completed work for a client and immediately received a payment of $900 cash. Completed work for Precept Paper Co. on credit, $1,700. Paid for the supplies purchased on credit on December 3. Paid for the annual $960 premium on an 2 3 4 8 10 14 Paid for the annual $960 premium on an insurance policy. 18 Received payment in full from Precept Paper Co. for the work completed on December 8. 27 Larry withdrew $650 cash from the practice to pay personal expenses. 30 Paid $175 cash for the December utility bills. 30 Received $2,000 from a client for financial services to be rendered next year. Prepare general journal entries to record these transactions. Explanations are Required. SCENARIO You are a recent graduate from one of the international universities. You have been approved to work at one of the well-known and famous organizations with this certificate. Your boss called you to his office on your first day of work to inform you of a task you must do. You were informed and ordered to create a project. The project aims to obtain a sum of money to be handed to the organization as a new employee. A payment of MYR 5 million every month for a year is required. You also need to pay the first payment after three months from the start of the project. The organization only cares about the money, not the means of creating it. Hence, all project planning is dependent on your creativity and critical thinking. QUESTION As an employee, explain your plan and the actions you will take to achieve that objective. You also must consider the probability of not being caught if your planning involves an abuse of the law. 1.CRIME THAT CAN BE DONE2.HOW TO DO THE CRIME?3.HOW TO DISTRIBUTE THE MONEY?4.STEPS THAT CAN BE TAKEN SO THAT THE COMPANY WON'T GET CAUGHT A project will result in a $25,000 increase in accountsreceivable and require a decrease in inventory levels by $10,000 to$95,000. What is the net cash flow for capital budgetingpurposes? Complete the following program that finds the sum and average of the numbers from 4 until a user specified number using a while loop. #include using namespace std; int main() { cout identify 3 different asset classes demonstrate an understanding of the risk/reward relationship for each of the asset classes know when it is appropriate to invest in each of the asset classes given each class's riskiness what risk are rating agencies grading for bond ratings what is an advantage of holding municipal bonds? What determines whether this is an advantage for the individual investor? What does the acronym TIPS stand for? What are TIPS used for? What is a zero-coupon bond? Why do investors generally hold bonds in a portfolio? Why do investors generally hold stocks in a portfolio? What is market capitalization? What does PE signify about a company? Consider the curve C that traces out the rectangle in the xy-plane with vertices (0,0), (-2,0), (-2,-3), and (0, -3) in that order (counter-clockwise). Use Green's theorem to compute the Integral of 5. A heterogenous catalyst was evaluated in the oxidation of methanol at 300 C The catalyst surface normalized rate was found to be 5.1 mmol/(s.m 2) The active site density of the catalyst was found 1.6 mmol/m 2Calculate the TOF of the catalyst in these conditions Which of the following is true regarding detectives/investigators?1.They are civilian employees of a police agency, without the power of arrest.2.Higher ranking police officers with more experience than patrol officers3.Their full-time job is to collect and analyze evidence4.All of the above are true Composition Imagine you had gone to sleep. When you woke up in the morning, you were either Spiderman, Superman or Batman. Write an account based on the following: What did you do in this situation? What was the reaction of your family members? Write about all your adventures. How did you feel when you woke up? Remember to write in paragraphs. (word limit 150-175) A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT You are interested in studying the perceived effectiveness of a new drug being used in the treatment of Alzheimer's disease. Given this intent of this study, apply the following: population, sample, parameter, and statistic. Calculate the accumulated amount of end-of-quarter payments of$7,000 made at 5.85% compounded monthly for 5 years. Round to thenearest cent POINTTS!!1 Describe the translation of y = The graph translates (x 3) + 2 from the parent function y = = x. 3 units unit down upleftright and updownleftright2 unit from the parent function Direct Materials Purchases Budget Marshall Publishers Inc. budgeted production of 38,000 diaries in 2016. Paper is required to produce a diary. Assume 89 square yards of paper are required for each diary. The estimated January 1, 2016, paper inventory is 237,000 square yards. The desired December 31, 2016, paper inventory is 118,000 square yards. If paper costs $0.17 per square yard, determine the direct materials purchases budget for 2016. If required, round your final answer to the nearest dollar...............