1. What does the acronym SHRM refer to? a. Social human resource
management b. Strategic human resource management c. Sustained
human resource management d. Strong human resource management

Answers

Answer 1

The acronym SHRM stands for Strategic human resource management.

Strategic human resource management (SHRM) is a management system that establishes a linkage between the organization’s overall strategic objectives and the HRM strategies.

By aligning these two, SHRM aims to maximize employee performance, which will, in turn, enhance the firm’s bottom line.

Here are a few things to keep in mind about SHRM:Strategic human resource management (SHRM) is becoming an increasingly important component of any business’s success.

To know more about Strategic visit:

https://brainly.com/question/26960576

#SPJ11


Related Questions

What is a particular problem that a House of representative
member has the ability to address. Please explain what problem they
could fix in length with a citation please!

Answers

One particular problem that a House of Representatives member has the ability to address is the issue of affordable healthcare access for all Americans. Access to affordable healthcare is a pressing concern in the United States, with many individuals and families struggling to afford necessary medical treatments and insurance coverage.

By working on healthcare policy and legislation, a House of Representatives member can contribute to improving the accessibility and affordability of healthcare services. They can propose and support bills that aim to expand healthcare coverage, reduce costs, and enhance the quality of care provided. Additionally, they can advocate for policies that address healthcare disparities and ensure equitable access to healthcare resources.

For example, a House of Representatives member could focus on advocating for the expansion of Medicaid, a government program that provides healthcare coverage for low-income individuals and families. By supporting the expansion of Medicaid eligibility criteria and funding, they can help increase the number of people who have access to essential healthcare services. This can have a significant impact on improving health outcomes and reducing financial burdens for vulnerable populations.

One citation that supports the importance of addressing healthcare access is a report by the Kaiser Family Foundation, which highlights the challenges faced by many Americans in accessing affordable healthcare. The report states that "as of 2019, 26.1 million nonelderly individuals in the United States were uninsured, representing 8 percent of the population" (Kaiser Family Foundation, 2021). This statistic underscores the need for legislative efforts to address healthcare access and affordability to ensure that all Americans have the opportunity to receive necessary medical care without facing financial hardship.

Learn more about affordable healthcare here:

https://brainly.com/question/33053961

#SPJ11

Luther Gulick and Clark Hetherington emphasized which program focus?

A. Education of the physical

B. Education through the physical

C. Naturalism

D. Play

E. Recreation

Answers

answer: B

Luther Gulick and Clark Hetherington emphasized the program focus of "Education through the physical" (Option B). They believed in the value of physical activities and sports as a means of educating individuals.

do
you think the act of discrimination and prejudice have a negative
effect on mental and physical health?

Answers

Discrimination and prejudice have detrimental effects on mental and physical health, contributing to chronic stress, mental health problems, and physical health disparities.

Experiencing discrimination and prejudice can profoundly impact an individual's mental and physical health. The persistent exposure to discriminatory attitudes and actions can lead to chronic stress, resulting in increased vulnerability to mental health issues such as anxiety and depression. Moreover, discrimination can create a hostile social environment, eroding self-esteem and causing social isolation. These psychological stressors can also have physical health consequences, including higher risks of cardiovascular disease, hypertension, and compromised immune function. Furthermore, discrimination limits access to essential resources and opportunities, perpetuating health disparities among marginalized individuals and communities. Addressing and challenging discrimination and prejudice are crucial for fostering inclusive societies that support the well-being of all individuals, both mentally and physically. By promoting equality and combating discrimination, we can strive for better overall health outcomes for everyone.

Learn more about stress here : https://brainly.com/question/10033876

#SPJ11

What strategies did enslaved people employ to resist, revolt, and sustain their own independent communities and cultures? How did enslaved individuals use White southerners’ own philosophies—paternalism and Christianity, for example—to their advantage in these efforts

Answers

Enslaved people employed strategies such as escape, sabotage, and forming maroon communities to resist and revolt. They used white southerners' paternalism and Christianity to manipulate and navigate oppressive systems, gain limited freedoms, and preserve their cultural practices.

To navigate oppressive systems is to adeptly maneuver through intricate webs of power and oppression, seeking paths of resilience and liberation. It involves understanding the rules and mechanisms of oppression while strategically challenging and subverting them.

It requires skillful awareness, calculated choices, and creative tactics to navigate within the constraints imposed by oppressive structures. It encompasses leveraging available resources, building alliances, and employing resistance strategies that dismantle, transform, or circumvent oppressive systems.

Navigating oppressive systems is a constant struggle to reclaim agency, challenge injustice, and carve out spaces of autonomy and dignity within oppressive societal frameworks.

Learn more about liberalism here:

https://brainly.com/question/29552197

#SPJ4

According to the article, There's no evidence that immigrants hurt any American workers, what accounts for the difference between Peri and Yasenov's conclusion and Borjas conclusion? Thoroughly discuss the various factors that influenced the results of those two studies. Why does Michael Clemens claim that -even if no one's wages actually changed, Goerge Borjas data would nevertheless have shown a decrease in the average wage after 1980.

Answers

There are a number of reasons why George Borjas' research on the effects of immigration on American workers differs from that of Giovanni Peri and Gianmarco Ottaviano's studies on this topic.

The study by Peri and Yasenov used an empirical technique called the "spatial correlation design," which looks at how changes in the local immigrant population affect native earnings. To identify the causal role of immigration, they used a natural experiment paradigm.

Data sources: The research might have used various datasets, which could have affected the outcomes. Data from the US Census Bureau, which offers thorough details on demographic and economic characteristics at the local level, was used by Peri and Yasenov.

Model specifications and assumptions: Varying model specifications and assumptions might produce different results. For example, Peri and Yasenov made assumptions about the spatial distribution of immigrants and the relationship between workers who are immigrants and those who are native-born.

It's vital to note that Michael Clemens' assertion regarding the statistics from Borjas and the average pay decrease only applies to hypothetical circumstances. Clemens contends that Borjas' data would still demonstrate a decline in average salaries after 1980 even if immigration had no impact on the actual wages of workers. This assertion is supported by the observation that immigrants frequently earn less on average than native-born workers. As a result, because of their lower earnings, immigrants who enter the labour market lower the average salary.

To know more about George Borjas:

https://brainly.com/question/7374619

#SPJ4

What do you believe is the single most influential force in today's society that sets the tone for an individual's personal values and why? Does this force affect Christians positively or negatively? What is your advice regarding this influential force?

Answers

The single most influential force in today's society that sets the tone for an individual's personal values is media.

Media has the power to shape the way people think, act, and perceive the world around them. Through movies, TV shows, news articles, social media, and other platforms, media has the ability to influence people's beliefs, attitudes, and behaviors.
Whether the influence of media is positive or negative depends on the individual and their personal values. For Christians, media can have both positive and individual's effects.

On one hand, media can provide Christians with access to valuable information, entertainment, and resources that can help them grow in their faith.

To know more about individual's  visit:

https://brainly.com/question/32647607

#SPJ11

Given your understanding of disproportionality and its complexities, what school/organizational level policies have you observed that affect disproportionality? This could be in your work environment or simply through outside observation of an institution that you are familiar with.

Answers

The disproportionality and its complexities, what school/organizational level policies have you observed that affect disproportionality: (i) Zero-tolerance policies (ii) Harsh disciplinary practices (iii) Inadequate cultural competence and bias (iv) Tracking and ability grouping (v) Special education identification and placement (vi) Resource allocation (vii) High-stakes testing

1.  Zero-tolerance policies: Zero-tolerance policies, which involve strict disciplinary actions for any violation, can contribute to disproportionality.

They often result in higher rates of suspension, expulsion, and school-based arrests, which disproportionately affect certain student groups, such as students of color and students with disabilities.

2.  Harsh disciplinary practices: Disciplinary practices that rely heavily on punitive measures, such as suspensions and expulsions, can disproportionately impact marginalized students.

Studies have shown that students of color and students with disabilities are more likely to receive harsher punishments for similar behaviors compared to their peers.

3.  Inadequate cultural competence and bias: Lack of cultural competence among teachers and administrators can contribute to disproportionality.

Stereotyping, implicit biases, and cultural misunderstandings can lead to different treatment and disciplinary decisions for students from diverse backgrounds.

4.  Tracking and ability grouping: The practice of tracking students into different ability groups or classes based on Special education identification and placement received academic abilities can perpetuate disparities.

Research suggests that these practices often result in students from disadvantaged backgrounds being overrepresented in lower tracks, limiting their access to advanced opportunities and resources.

5.  Special education identification and placement: The process of identifying and placing students in special education programs can also contribute to disproportionality.

Students from certain racial or ethnic backgrounds, particularly Black and Hispanic students, are overrepresented in special education, which can lead to segregation and limited access to general education curriculum.

6.  Resource allocation: Unequal distribution of resources, such as highly qualified teachers, advanced courses, and support services, can perpetuate disparities.

Schools with lower funding and fewer resources are more likely to serve marginalized communities, leading to gaps in educational opportunities and outcomes

7.  High-stakes testing:  Reliance on high-stakes standardized tests for school accountability and student promotion can exacerbate disproportionality.

These tests can disadvantage certain student groups, including English language learners and students from low-income backgrounds, leading to unequal educational opportunities.

It's important to note that these policies and practices interact in complex ways, and their effects on disproportionality may vary depending on specific contexts and implementation.

Addressing disproportionality requires a comprehensive approach that considers multiple factors, including policy changes, professional development for educators, and the promotion of inclusive and equitable practices.

Learn about more environment here: brainly.com/question/11999587

#SPJ11

which of the following statements best explains the observation that there are more autism cases now than in the past? there are more parents who neglect their children, which is a cause of autism, now than in the past. autism has been selected for in recent generations by natural selection. the vaccine for measles, mumps, and rubella has been established as a significant cause of autism. doctors are more aware of the condition and have better techniques for diagnosing and reporting it. all of the above are equally good explanations for the observation that there are more autism cases now than in the past.

Answers

The statement that best explains the observation of an increased number of autism cases now compared to the past is doctors are more aware of the condition and have better techniques for diagnosing and reporting it.

The option (D) is correct.

Improved awareness and diagnostic practices play a significant role in identifying and reporting autism cases more effectively than in previous years. This increased awareness leads to higher detection rates and a better understanding of the condition.

The other statements, such as parental neglect, natural selection, or the vaccine for measles, mumps, and rubella, have not been supported by scientific evidence and are not considered valid explanations for the observed increase in autism cases.

Learn more about autism:

https://brainly.com/question/29930490

#SPJ4

This question is not complete, Here I am attaching the complete question:

Which of the following statements best explains the observation that there are more autism cases now than in the past?

(A) there are more parents who neglect their children, which is a cause of autism, now than in the past.

(B) autism has been selected for in recent generations by natural selection.

(C) the vaccine for measles, mumps, and rubella has been established as a significant cause of autism.

(D) doctors are more aware of the condition and have better techniques for diagnosing and reporting it.

(E) all of the above are equally good explanations for the observation that there are more autism cases now than in the past.

Question 46 1.43 points ✓ Saved The Civil Rights Act enforces discrimination against minorities regardless of the costs involved. When the government enforces the Americans with Disabilities Act (ADA), it has to consider O A. reverse discrimination O B. undue hardship O C. quotas OD. qualifications and standards O E. the impact on local communities A Moving to another question will save this response. << Question 46 of 70 > >>

Answers

The Americans with Disabilities Act is a civil rights law that was passed in 1990.

It prohibits discrimination against individuals with disabilities in all areas of public life, including employment, transportation, and public accommodation.

The question asked which factor the government has to consider when enforcing the Americans with Disabilities Act (ADA). The answer is B.

undue hardship.Undue hardship is a term used in the ADA that refers to significant difficulty or expense in making a change or accommodation in the workplace or public accommodations for a person with a disability.

To know more about Disabilities visit:

https://brainly.com/question/31662784

#SPJ11

reynaldo has an irrational fear of cats and has all the symptoms of a phobia. knowing that some behavioral techniques are effective with fears of certain types, his therapist decides to bring a cat into the office. which behavioral technique is the therapist using? question 27

Answers

In vivo exposure behavioral technique is the therapist using. The right answer is 2.

A psychological therapy called exposure therapy was created to assist patients in facing their concerns. In exposure therapy, psychologists set up a secure setting in which to "expose" patients to the things they avoid or find frightening. Exposure to the dreaded things, actions, or circumstances in a secure setting aids in lowering anxiety and lowering avoidance.

In-vivo exposure is coming face-to-face with a dreaded thing, circumstance, or activity. For instance, a person with a phobia of snakes would be told to handle a snake, while a person who struggles with public speaking might be told to do so

The correct answer is option 2.

Know more about In vivo exposure here

https://brainly.com/question/32727839

#SPJ4

The question seems incomplete. The complete question is:

Reynaldo has an irrational fear of cats and has all the symptoms of a phobia. Knowing that some behavioral techniques are effective with fears of certain types, his therapist decides to bring a cat into the office. Which behavioral technique is the therapist using?

1. Imaginal exposure

2. In vivo exposure

3. Virtual exposure

4. Sudden exposure

Cultivating cultural awareness: Investigate a culture of your choice. Look for the points below. 1.Culture - Important cultural events 2.Language Learning to speak simple phrases 3.Norms - Do's and Dont's in another culture Write a paragraph each on the points above. How does knowing these help you with communicating with other people from that culture?

Answers

Cultivating cultural awareness is a crucial element for communication.

It is an approach that involves acquiring knowledge of diverse cultures to better understand people from different backgrounds.

Investigating a culture of choice can bring new insights into the lifestyle of people from different regions and lead to better intercultural communication. In this essay, I will examine the importance of culture, language, norms, and how knowing them can help with communicating with other people from that culture.  

Culture – Important cultural events  Each culture has unique cultural events that reflect the history, beliefs, and traditions of its people.

To know more about awareness visit:

https://brainly.com/question/14427673

#SPJ11

The Deficit Myth: Questions #1
Every student should read the Introduction and Chapter 1 of The Deficit Myth. Bring written answers to: question 1, as well as, 2 other questions of your choosing from the list. You may always answer question 1 additional times instead of answering other questions, but you should end up with 3 answers in total.
Each answer should be a short paragraph (2-5 sentences) and can be hand-written or typed and should be brought with you to your discussion session.
What is something in this reading which you did not understand? Describe what you understand about it and explain where your confusion lies. Alternatively, if you had an ‘Ah-hah!’ moment while reading the text, you can describe what it is that you were unclear about before, but now understand.
Dr. Kelton spends a lot of time talking about currency, its creation and function. Who is currency issuer, why do they issue currency, and who is a currency ‘user’?
What is a monopoly? What monopoly market does Dr. Kelton talk about? Who controls this market and how?
What is the purpose of taxes?
Can the government have a balanced budget or budget surplus forever? Why or why not?

Answers

In the reading, I did not fully understand the concept of the currency issuer and currency user. From what I gathered, the currency issuer refers to the entity or authority responsible for creating and issuing the currency, which in most cases is the government.

Question 1

They issue currency to facilitate economic transactions and provide a medium of exchange. On the other hand, the currency user refers to individuals, businesses, and other entities that utilize the currency for various transactions. However, I am still unclear about the specific mechanisms and dynamics involved in the relationship between the currency issuer and the currency user.

Question 2:

Dr. Kelton discusses the concept of a monopoly in the reading. A monopoly refers to a market structure where there is only one seller or producer of a particular good or service, giving them significant control and influence over the market. Dr. Kelton talks about the monopoly market of currency creation, where the government holds the power to create and issue currency. The government controls this market and has the authority to regulate the supply of money and determine its value through policies and monetary instruments.

Question 3:

The purpose of taxes, as mentioned in the reading, is not solely to fund government spending, but also to drive and manage the overall economy. Taxes act as a tool for income redistribution, promoting economic stability, and achieving social objectives. By collecting taxes, the government can finance public goods and services, address income inequality, regulate economic activities, and control the overall money supply.

Question 4:

According to the reading, the government can have a balanced budget or budget surplus, but it may not be sustainable or desirable in the long run. A balanced budget means that government spending equals government revenue, resulting in no deficit. However, a perpetual balanced budget or surplus may not be ideal as it can lead to stagnation and insufficient injection of money into the economy. Government spending plays a crucial role in stimulating economic growth and addressing social needs, and a perpetual balanced budget may restrict the government's ability to respond to changing economic conditions and fulfill its obligations.

To know more about monopoly   here

https://brainly.com/question/7217942

#SPJ4

which of the following best explains the failure of recent ethics legislation initiatives? a. changing these policies would require a state constitutional amendment. b. the constitution prohibits efforts to limit campaign contributions or revolving door appointments. c. there is no public support for reform efforts because most people benefit from the current system. d. funding problems have led legislators to rely upon interest group funds. e. reforms are often resisted by individuals and groups who benefit from the status quo.

Answers

The best explanation for the failure of recent ethics legislation initiatives is which states that reforms are often resisted by individuals and groups who benefit from the status quo.

The option (E) is correct.

This suggests that there are influential individuals and interest groups that have a vested interest in maintaining the current ethical framework, which may be advantageous to them in various ways. These entities may resist and impede efforts to implement ethics reforms, either through lobbying, political influence, or other means.

Their resistance can make it challenging to pass legislation or enact significant changes to existing ethics policies. This dynamic highlights the inherent difficulties in challenging and overcoming entrenched interests when it comes to ethics reforms.

Learn more about legislation:

https://brainly.com/question/1151838

#SPJ4

in the united states, citizens have the right to free speech whether it agrees with the government or not. this is an example of

Answers

In the United States, the fact that citizens have the right to free speech, regardless of whether it agrees with the government or not, is a key example of the principle of freedom of expression.

This principle is enshrined in the First Amendment of the U.S. Constitution, which protects the rights of individuals to express their opinions, beliefs, and ideas without fear of government censorship or retaliation.The historical context of this right can be traced back to the Founding Fathers' belief in the importance of individual liberties and the need to prevent government suppression of dissenting views. The framers of the Constitution recognized that a robust and diverse marketplace of ideas is vital to a functioning democracy.In modern times, the freedom of speech continues to play a crucial role in American society. It allows citizens to openly criticize the government, engage in political discourse, advocate for social change, and express themselves creatively. This right also fosters a culture of innovation, intellectual growth, and democratic participation.

Overall, the recognition and protection of free speech, even when it conflicts with the government, serves as a fundamental pillar of American democracy, ensuring that citizens can voice their opinions and contribute to public debate without fear of reprisal.

For more such question on citizens

https://brainly.com/question/632570

#SPJ8

Write a short two-page paper on ""blood diamonds"" and/or ""ethical diamonds."" Define each and explain the positives and negatives for this social sustainability issue. What should be the role of diamond producers? What is the role of operations managers in this industry?

Answers

We will make a distinction between ethical diamonds and conflict-free diamonds for the purposes of this paper. Diamonds that have not been used to support civil conflicts are said to be conflict-free. In addition, ethical diamonds guarantee fair wages, secure working conditions, eco-friendly procedures, and no violations of human rights.

The stones, commonly referred to as "Conflict Diamonds," are created in regions under the authority of rebel groups that resist internationally recognised governments. These diamonds are sold by the rebels, who then use the proceeds to buy weapons or support their military operations. In addition to deforestation, soil disturbance, air emissions, surface water pollution, groundwater contamination, dust, noise, worker health and safety, and other issues, the extraction of mineral resources also permanently harms the ecosystem.

To learn more about conflicts, click here.

https://brainly.com/question/33569417

#SPJ4

Chapter 01 Test Prep: The Evolution of Psychology
Jenny and Rachel witnessed a fight at school, Jenny had nightmarse for days after seeing the altercation while Rachel had forgotten about the fight the next day. The difference in their reactions can be explained because
a. Rachel doesn’t care for others, so the fight didn’t matter
b. Reactions to stimuli are personal and subjective
c. Processing stimuli is passive so there is no reason for the fight to cause the reaction of either girl
d. Perception are empirical.

Answers

The difference in Jenny and Rachel's reactions to witnessing the fight can be explained by the fact that: b. Reactions to stimuli are personal and subjective.

Individuals' reactions to stimuli can vary based on their personal experiences, emotions, and psychological factors. In this case, Jenny had nightmares for days, indicating a strong emotional response to the altercation she witnessed. On the other hand, Rachel quickly forgot about the fight, suggesting a different or less intense emotional reaction. These varying reactions highlight the subjective nature of how individuals perceive and respond to stimuli. A stimulus is a perceptible alteration in the internal or external surroundings of an organism's physical or chemical makeup. Sensitivity is the capacity of an organism or organ to recognise external stimuli and to respond appropriately to them.

To know more about stimuli

https://brainly.com/question/30714457

#SPJ11

The beliefs included in this diagram apply to:
- Reincarnation
· Karma
· Caste system
A. both Hinduism and Buddhism.
B. Hinduism, but not Buddhism.
C. Buddhism, but not Hinduism.
D. neither Hinduism nor Buddhism. I think it's either B or A

Answers

Answer:

B Hinduism but not Buddhism

(Side note: Hinduism does not talk about the caste system this is more of a cultural structure, however, reincarnation and karma are mainly Hindu beliefs rather than Buddhist)

Which of the following is NOT a stage in developing a shared vision? O develop trust empower the individual O share the vision O reward performance O measure commitment
Of five styles representing di

Answers

Developing a shared vision is a process that is used to create a clear, compelling image of an organization’s desired future.

It's the foundation for all of the other strategic planning activities because it provides direction and helps to ensure that everyone is working toward the same goal.The following is not a stage in developing a shared vision: Reward performance.
Explanation:
Developing a shared vision involves several stages that include empowering individuals, sharing the vision, measuring commitment, and developing trust.

The goal of this process is to foster teamwork and create a shared understanding of the future.

To know more about organization’s visit:

https://brainly.com/question/12825206

#SPJ11

are generally more serious than , but less serious than . a) misdemeanors; offenses; felonies b) felonies; misdemeanors; offenses c) misdemeanors; felonies; offenses d) offenses; misdemeanors; felonies

Answers

The correct answer is option (c): misdemeanors; felonies; offenses.

Misdemeanors are generally less serious offenses compared to felonies but more serious than minor offenses. Misdemeanors are typically punishable by fines, probation, community service, or a short jail sentence.

Felonies, on the other hand, are more serious crimes that often involve violence, significant harm, or major property damage. They carry harsher penalties, such as imprisonment for more than one year, substantial fines, or even the death penalty in some jurisdictions.

"Offenses" is a more general term that encompasses both misdemeanors and felonies, referring to any violation of the law or rules that may carry legal consequences, regardless of the severity.

Therefore, the correct order from less serious to more serious offenses is misdemeanors, offenses, and then felonies.

To know more about  misdemeanors  here

https://brainly.com/question/20348390

#SPJ4

carbough describes three ways one might think about the question "who am I?". These are the Biological Idiom, the Psychological Idiom, and the Cultural Idiom. He then proposes a fourth, which he calls the "Cultural Pragmatic Idiom". How in your view, is the cultural pragmatic idiom Carbough describes different from these?

Answers

The Cultural Pragmatic Idiom differs from the other three by emphasizing the influence of cultural context and social interactions in shaping one's identity.

The Biological Idiom views personal identity primarily through biological factors such as genetics, physical traits, and physiological processes. The Psychological Idiom focuses on psychological aspects such as personality, cognitive processes, and individual experiences in defining identity.

The Cultural Idiom considers the influence of cultural norms, values, beliefs, and socialization processes on shaping identity.

In contrast, the Cultural Pragmatic Idiom introduced by Carbough highlights the dynamic nature of identity formation, emphasizing the role of cultural context and social interactions in shaping one's sense of self.

It recognizes that identity is not solely determined by biology or individual psychology, but rather influenced by the cultural and social environments one is situated in.

This perspective acknowledges the importance of social relationships, language, cultural practices, and societal expectations in shaping and negotiating one's identity.

The Cultural Pragmatic Idiom goes beyond the individual and highlights the interactive nature of identity, where individuals actively engage with their cultural context and adapt their identity to fit social expectations and navigate various cultural situations.

It underscores the significance of cultural pragmatism and contextual understanding in understanding personal identity.

Learn more about socialization here:

https://brainly.com/question/12881643

#SPJ11

Why do you think Greek Orthodox Christianity became
popular in Eastern Europe whereas Catholic Christianity was popular
in Western Europe?

Answers

According to our observations, Greek Orthodox Christianity spread over Eastern Europe because it functioned as a body or organization.  

What is Greek Orthodox Christianity?

They get united and accept one another as Christians in this place thanks to the church. Following mutual acknowledgment of one another, Greek Orthodox Christians think that the source of the Church's unity is the shared profession of faith.  

Orthodox Christians consider Jesus Christ to be the head of the church in both heaven and on earth.  It regards Jesus Christ as God's son.  According to Eastern Christianity, the Trinity is composed of three different heavenly races.  They hold that the Father created the Son before the Earth was formed.  The only author is God the Father.

Learn more about Greek Orthodox Christianity here:

https://brainly.com/question/28205139

#SPJ4

Compare and contrast Relationship based theory
and Transactional theory ( CD
251). Identify multiple ways in which they are similar,
as well as multiple ways in which they differ.

Answers

Relationship-based theory and transactional theory are two approaches in the field of communication that focus on understanding interpersonal interactions. While they share some similarities, they also differ in several aspects.

Both relationship-based theory and transactional theory emphasize the importance of communication in relationships. They recognize that communication plays a central role in shaping and maintaining relationships. Both theories acknowledge that communication is a dynamic process that involves the exchange of messages and the interpretation of meaning.

One key difference between the two theories is their focus. Relationship-based theory places a stronger emphasis on the relational aspects of communication. It highlights the significance of building and maintaining meaningful connections, understanding emotions, and fostering empathy in interpersonal interactions.

Transactional theory, on the other hand, focuses more on the exchange of messages and the transactional nature of communication. It views communication as a series of transactions where individuals engage in give-and-take interactions to accomplish their goals.

Another difference lies in the underlying assumptions of each theory. Relationship-based theory assumes that relationships are inherently important and that individuals strive for relational satisfaction. It emphasizes the need for closeness, intimacy, and trust in relationships. Transactional theory, on the other hand, assumes that individuals primarily seek to achieve their personal goals through communication. It highlights the role of power dynamics, negotiation, and influence in interpersonal interactions.

In summary, while both relationship-based theory and transactional theory recognize the significance of communication in relationships, they differ in their focus and underlying assumptions. Relationship-based theory emphasizes relational aspects, emotions, and empathy, while transactional theory focuses on the exchange of messages and the achievement of personal goals.

Learn more about Relationship-based theory here:

https://brainly.com/question/28197754

#SPJ11

Cinema advertising is unimportant in the United states but a
major media in such countries in Austria. Why?

Answers

Cinema advertising is unimportant in the United States but a major media in such countries in Austria because Austria employs a sizable portion of all film advertising as a workaround to high taxes imposed on the other media. The enormous amount of money spent on this medium each year, more than 10% of all advertising expenditures in the nation shows the success of this sort of marketing.

Advertising is a method of promoting an item to a target market where communication is meant to persuade a market to buy a product, an idea, or a service whether they want it or not.

The term "Cinema of Austria" describes the Austrian cinema industry. Since the early 20th century, when Austria was a part of the Austro-Hungarian Empire, there has been a thriving film industry there.

Learn more about Cinema advertising, here:

https://brainly.com/question/29998497

#SPJ4

In contrast to John Rawls, Robert Nozick contends that the proper role of government is not to meddle with the distribution of resources so as to produce a "fair" distribution. Instead, the right to self-ownership and the right to hold property, free of government intervention, are paramount. What does Nozick mean by self-ownership and the right to property? How does Nozick’s conception of fairness differ from Rawls’s?

Answers

Robert Nozick, a prominent political philosopher, presents a contrasting view to John Rawls regarding the role of government and the concept of fairness in the distribution of resources.

Nozick argues that the primary role of government is not to actively intervene in the distribution of resources to achieve a specific notion of fairness. Instead, he emphasizes the importance of individual rights, particularly the rights of self-ownership and property.

When Nozick refers to self-ownership, he means that individuals have the right to control their own bodies and make decisions about their own lives. It encompasses the idea that individuals have the freedom to act as they see fit, provided they do not violate the rights of others. Nozick sees self-ownership as a fundamental right, and he believes that any interference with this right is a violation of individual liberty.

Regarding the right to property, Nozick argues that individuals have the right to acquire and hold property through legitimate means, such as voluntary exchanges and acquisitions. He emphasizes that people should be able to keep what they acquire without interference from the government. Nozick sees property rights as extensions of self-ownership, where individuals have the right to the fruits of their labor and the ability to transfer or exchange property voluntarily.

Nozick's conception of fairness differs from Rawls's in that he rejects the idea of a distributive justice principle that requires active government intervention to achieve a fair distribution of resources. Nozick argues that any redistribution of resources by the government, even with the intention of promoting a more equal society, is a violation of individual rights. He contends that individuals have a right to the fruits of their labor and voluntary exchanges, and any forced redistribution is akin to a form of coercion.

In contrast, Rawls's concept of fairness, as outlined in his influential work "A Theory of Justice," involves the principle of justice as fairness. Rawls argues for a system where inequalities are permitted if they benefit the least advantaged members of society and are attached to positions open to all under fair conditions. He advocates for a more active government role in redistributing resources to ensure a more equitable distribution and address social and economic disparities.

Overall, Nozick's perspective prioritizes individual rights, self-ownership, and property rights, while rejecting extensive government intervention in resource distribution. In contrast, Rawls emphasizes the role of the government in actively redistributing resources to achieve a fairer and more just society.

To know more about  political philosopher, here

https://brainly.com/question/2292054

#SPJ4

What percentage of customers trust online video ads as credible sources of buying information?
a) 68 percent
b) 57 percent
c) 17 percent
d) 29 percent
e) 48 percent
Question 10: Use this information for questions that refer to the World Tennis Ball (WTB) Company case.
World Tennis Ball Co. (WTB) makes tennis balls and sells them only in the United States. Raul Fernandez, the firm's marketing manager, is comparing his firm's distribution with two major competitors.
1) WTB sells its products through four regional distributors, who then sell to 22 sporting goods wholesalers. The wholesalers sell to a total of 7,000 retail outlets. From its website, WTB also sells directly to any customer who will purchase a minimum quantity of 24 tennis balls. WTB cooperates with members of its channel but maintains some control through its economic power and leadership. It helps to direct the activities of the whole channel and tries to avoid or resolve channel conflicts.
2) American Tennis Ball (ATB) is a competitor that sells through two distributors—each with half the country. The distributors then sell through six sporting goods wholesalers, and they, in turn, sell to 1,000 retail outlets (split between two national sporting goods chains and two general merchandise stores). ATB and its channel make little effort to work together. However, because of a relatively low level of competition between the distributors, the wholesalers, or the retail stores, each member of the channel gives the product special attention.
3) National Tennis Ball (NTB) sells its products through only three tennis specialty wholesalers that sell only to tennis clubs. NTB actually owns the wholesale firms that handle its products. NTB's balls are only available at certain tennis clubs and NTB limits coverage to only one club in a particular geographic area.
National Tennis Ball's channel arrangement
Multiple Choice
a) is an example of intensive distribution.
b) relies on exclusive distribution.
c) illustrates a traditional channel system.
d) is called horizontal distribution.
e) is likely to be characterized by a high level of conflict between channel members.

Answers

1. NTB's channel arrangement is an example of exclusive distribution. Therefore option B.

3. 48% of customers trust online video ads as credible sources of buying information. This is according to a 2012 Nielsen survey.

What is the meaning of exclusive distribution?

Exclusive distribution is a type of distribution strategy in which a manufacturer grants a single retailer the exclusive right to sell its products in a specific geographic area.

This type of distribution strategy is often used for luxury goods or other products that are considered to be high-end or exclusive.

NTB's distribution strategy is designed to create a sense of exclusivity around its products. By limiting the availability of its products to a limited number of channel members, NTB is able to create a sense of demand for its products and to charge a premium price.

Find more exercises on Exclusive distribution;

https://brainly.com/question/28173505

#SPJ4

Who helps the pilgrims survive their first winter in North America? the Wampanoag O King Philip the Lenape They suffered the first winter alone.

Answers

The Wampanoag helped the pilgrims survive their first winter in North America. The correct option is a.

The Wampanoag (/wmpn/), also spelt Wôpanâak, were a Native American tribe from the Northeastern Woodlands who reside in areas of eastern Rhode Island and southeastern Massachusetts. Their ancestral homelands include the islands like Martha's Vineyard and Nantucket.

The Wampanoag was a significant confederation comprising at least 24 known tribes when they had their first contact with the English in the 17th century. There were thousands of them; alone on Martha's Vineyard, there were 3,000 Wampanoag. A leptospirosis outbreak that occurred between 1615 and 1619 significantly decreased the Wampanoag and surrounding tribes' population.

Learn more about Wampanoag, here:

https://brainly.com/question/29519444

#SPJ4

Only if possible I would like you to draw your conclusion from this book: Social Psychology by Elliot Aronson, Timothy D. Wilson, Robin M. Akert Eight Edition.

Please answer the following questions. Give as much information as you can! there is no word limit so please provide as much information as you can find to assist me! For example at least 1 paragraph per question.

1) How does social psychology do research?

2) How is social psychology different from other disciplines?

3) In your own words, define social psychology and give examples of the discipline’s central questions, concerns, and/or topics. What do the general topics in Social Psychology seem to have in common (i.e. how are they
similar)?

4) how does society, Culture, history, religion, social norms, etc influence social behaviour?

Answers

Social psychology, as described in the book "Social Psychology" by Elliot Aronson, Timothy D. Wilson, and Robin M. Akert (8th Edition), conducts research through various methods to understand human behavior in social contexts.

Social psychology distinguishes itself from other disciplines by focusing on the influence of social factors on individual behavior and cognition. While related to fields like sociology and psychology, social psychology specifically emphasizes the impact of social interactions, norms, and group processes on individual attitudes, beliefs, and behavior.

It examines the interplay between the individual and the social environment, investigating how individuals' thoughts, feelings, and behaviors are shaped by social influences and how they, in turn, influence others. Social psychology also explores the role of social cognition, such as how individuals perceive, interpret, and make judgments about themselves and others in social situations.

In simple terms, social psychology can be defined as the study of how individuals' thoughts, feelings, and behaviors are influenced by the presence of others. It seeks to understand how social situations shape our perceptions, attitudes, and actions. The discipline's central questions revolve around understanding the factors that influence conformity, obedience, attraction, aggression, stereotypes, prejudice, altruism, and group dynamics.

For example, social psychologists might investigate why people conform to group norms, how stereotypes affect our judgments of others, or why individuals help strangers in need. These topics share a common thread of exploring how social influences shape and impact human behavior, cognition, and emotions within various social contexts.

Society, culture, history, religion, social norms, and other social influences play a significant role in shaping social behavior. These factors shape our attitudes, beliefs, and behaviors through various mechanisms. Society provides individuals with norms and expectations that guide their conduct and shape their interactions with others.

Culture influences our values, beliefs, and social practices, which can impact how we perceive and behave in social situations. Historical events and societal changes can also influence social behavior by shaping collective memory and attitudes. Religion often provides moral and ethical frameworks that guide social interactions and influence individuals' behavior.

Overall, social behavior is intricately intertwined with the broader social context, and understanding these influences is crucial in comprehending human behavior in a social psychology framework.

Learn more about human behavior here : https://brainly.com/question/31168448

#SPJ11

anya pulled all-nighters both last night and the night before. tonight, finally, she anticipates going to bed at her usual time. anya will spend a greater proportion of her sleep time than usual in sleep, a phenomenon called .

Answers

Anya will spend a greater proportion of her rest time than common in profound rest, a peculiarity called sleep rebound.

The option (A) is correct.

Sleep rebound occurs when an individual experiences a significant deprivation of sleep and then compensates for it by spending more time in the deeper stages of sleep during subsequent sleep episodes.

During deep sleep, also known as slow-wave sleep, the body undergoes important restorative processes, such as tissue repair and growth, immune system strengthening, and memory consolidation. The sleep rebound allows the body to catch up on the lost sleep and restore its normal sleep patterns, promoting overall well-being and functioning.

Learn more about Anya:

https://brainly.com/question/14774269

#SPJ4

This question is not complete, Here I am attaching the complete question:

anya pulled all-nighters both last night and the night before. tonight, finally, she anticipates going to bed at her usual time. anya will spend a greater proportion of her sleep time than usual in sleep, a phenomenon called .

(A) sleep rebound.

(B)  sleep out- bound.

(C) None.

Fatima is wondering how she can help her son, Ali, improve his grades. He is not completing his homework orstudying. Ali claims that the work is too hard for him, and he cannot complete the tasks. She knows that you are studying psychology and she is looking foryour help to change his behaviour. Fatima is a teacher, and she could help him studying. His older brother is also in university and studied the same subjects that Ali is currently studying. Select 2 perspectives of psychology and explain how this perspective could be used to improve the student's grade.

• I can identify 2 appropriate perspectives from psychology
• I can explain how two chosen perspectives of psychology could be used to change the student's behaviour to improve his grades with relevant supporting details/facts
• I can provide one specific example from each perspective that Fatima could do.
• I am able to link evidence from the texts to support both of my answers.

Answers

Two perspectives from psychology that could be used to improve the student's grades are behavioral psychology and social-cognitive psychology.

Behavioral Psychology: This perspective focuses on the relationship between behavior and environmental factors, particularly reinforcement and punishment. Fatima can utilize principles from behavioral psychology to motivate Ali to complete his homework and study. One specific example is implementing a reward system where Ali earns points or privileges for completing his assignments or studying for a certain amount of time. This positive reinforcement can help reinforce the desired behavior and make it more likely for Ali to engage in academic tasks.

Social-Cognitive Psychology: This perspective emphasizes the role of cognitive processes and social influences in shaping behavior. Fatima can apply principles from social-cognitive psychology to address Ali's belief that the work is too difficult for him. One specific example is modeling. Fatima can involve Ali's older brother, who has already successfully studied the same subjects, in helping Ali understand and complete his assignments. By observing his brother's successful study habits and strategies, Ali may gain confidence in his own abilities and be more motivated to tackle the tasks.

Learn more about psychology here:

https://brainly.com/question/13044291

#SPJ11

a teacher believes that giving her students a practice quiz every week will motivate them to study harder, leading to a greater overall understanding of the course material. she tried this technique for a year, and everyone in the class achieved a grade of at least c. is this an experiment or an observational study? a. b. c. d. e. an experiment, but with no reasonable conclusion possible about cause and effect an experiment, thus making cause and effect a reasonable conclusion an observational study, because there was no use of a control group an observational study, but a poorly designed one because randomization was not used an observational study, and thus a reasonable conclusion of association but not of cause and effect

Answers

This situation can be named a trial, however with no reasonable conclusion possible about cause and effect. The teacher implemented the practice quiz technique intentionally to observe its effects on the student's motivation.

The option (A) is correct.

However, without a control group or random assignment, it is difficult to establish a causal relationship between the practice quizzes and the improved grades. Other factors, such as individual differences, teaching methods, or external influences, may have contributed to the student's achievement.

While an association between the practice quizzes and improved grades is observed, it is not possible to definitively determine that the quizzes alone caused positive outcomes.

Learn more about teacher:

https://brainly.com/question/18529141

#SPJ4

This question is not complete, Here I am attaching the complete question:

A teacher believes that giving her students a practice quiz every week will motivate them to study harder, leading to a greater overall understanding of the course material. she tried this technique for a year, and everyone in the class achieved a grade of at least c. is this an experiment or an observational study?

(A) an experiment, but with no reasonable conclusion possible about cause and effect an experiment, thus making.

(B) cause and effect a reasonable conclusion an observational study, because there was no use of a control group an observational study.

(C) but a poorly designed one because randomization was not used an observational study.

(D) and thus a reasonable conclusion of association but not of cause and effect.

Other Questions
When hydrogen and nitrogen combine to form ammonia, 6 grams of hydrogen react with 20 grams of nitrogen to form 34 grams of ammonia # 12 grams of tydrogen read with 66 grams of bogen predet how many grams of ammonia you would expect to form O 08 grams O O 12 grams 34 grama 2. Indicate factors, caused the coagulation of HMW protein solutions: A. Addition of electrolytes solutions to colloidal solutions of HMW compounds; B. Addition of dehydration agents: C. Addition of solvent: D. Addition of other HMWC solution. answer this question plese You are required to scan the following array from a user. [1,2,3,4,4,4,2,1,1,1,1] And draw a histogram of its elements like this. Make a class called 'RecordHolder' that has 4 properties, name, year, artist, and value. When a Record Holder object is initialized, it should take parameters for all 4 properties (name, year, artist, and value). Make the __str_function return some string representation of the Record Holder (ex. Name: name_here Year: year_here etc) and write a function called update that asks for the current price of the record and updates the object. (Approx. lines of code: 10-15) Sunland Incorporated management is considering investing in two alternative production systems. The systems are mutually exclusive, and the cost of the new equipment and the resulting cash flows are : Carbon monoxide is completely burned, at a pressure of 1 atm, with excess air. If reactants enter at 200F, products leave at 1800F, and heat losses are negligible, what percentage of excess air was used? Question 17 Homework Unanswered The current equilibrium price of oil is $100 per barrel and the equilibrium quantity of oil is 96 million barrels per day. OPEC increases its oil production by 4 million barrels per day. The price elasticity of demand for oil is -0.2, while the supply of oil is perfectly inelastic over the period of time in question. Based on this information, you predict that after the OPEC's production increase, the equilibrium price of oil will be $ per barrel. Type your numeric answer and submit Fill in the Blanks Type your answers in all of the blanks and submit X, Suppose Amazon raises its Prime membership fee from $119 to $139. The price elasticity of demand for Amazon Prime subscriptions in this price range is -1.2. You predict that the quantity of subscriptions demanded will (increase/decrease) Write your response here.... by Type your answer here. % and that Amazon's total revenue will (increase/decrease) Write your response here.... by Type your answer here. What is the sentence pattern of the given sentence?Neil painted his house.Subject - Verb of being - AdjectiveO Subject - Verb transitive - Indirect object - Direct objectO Subject - Transitive verb - Direct ObjectO Subject - Transitive Verb - Adverb A marginal abatement cost that shows a factory'spollution is represented by MAC= 360 - 5E with a tax per unit equalto 20$. How much will the factory reduce its emissions? SHOW FULLCALCULATIONS The property and equipment section of the lululemon athletica 2018 balance sheet follows. Property and Equipment (in thousands) Feb. 3, 2019 Jan. 28, 2018 Land $78,636 $83,048 Buildings 38,030 39,278 Leasehold improvements 362,571 301,449 Furniture and fixtures 103,733 91,778 Computer hardware 69,542 61,734 Computer software 230,689 173,997 Equipment and vehicles 15,009 14,806 Work in progress 74,271 51,260 Property and equipment, gross 972,481 817,350 Accumulated depreciation (384,982) (326,523) Property and equipment, net $587,499 $490,827 Depreciation expense related to property and equipment was $116.3 million and $102.6 million, for the years ended February 3, 2019, and January 28, 2018, respectively.c. Compute the estimated percent used up of lululemons depreciable assets. Note: Round percentage to one decimal place (for example, enter 6.7% for 6.6555%). Answer % 2. List out the primary key(s), foreign key(s) and candidate key(s) for the CustomerOrder table. For this question, you only need to consider the relationship(s) between the CustomerOrder table and the tables within the Order Schema. Do not refer to, or in any way utilize, tables outside of the Order Schema. 22 If we group the first two farms and the last two terms as follows (xy+5y) + (2x + 10) Group 1 what do you notice about each group? Group 2 the Suplay y 12, +alls (1) 23 Factor these values out of each group and then write down the equivalent algebraic expression. 24 What is the common factor in the two terms? 25 Use the distributive property to factor out this common factor and then express the polynomial as a product of two binomials What is the greenhouse effect needed to reach an actual averagetemperature T = 288 K on earth? Classify the following as Homogeneous mixture, Heterogeneousmixture or Pure substance.HCl (aq) Is triangle fgh similar to triangle jkl? If so, identify the similarity postulate or theorem that applies. (Please help!!!) Solve the initial value problem below using the method of Laplace transforms. w +4w=8t^2 +4,w(0)=2, w (0)=20 Click here to view the table of Laplace transforms. Click here to view the table of properties of Laplace transforms. w(t)= 5. Based on your knowledge on basins and domes, what would be the structure associated with the rocks in the northwestern part of the state? (Hint: examine the geologic map and cross-section of Michigan) An atom of 235U absorbs a neutron and undergoes fission, producing 132Sn and 12Mo as fission fragments. 50 42 (a) What is the decay chain initiated by each of the fission fragments? (b) Write the overall fission reaction, taken to the stable end products. (Use x for the number of gamma rays emitted.) (c) How much energy is eventually released? CAN YOU PLEASE ANSWER THIS BIOINFORMATIC QUESTION ASAP!John Louis has been suffering from pancreatic cancer. His DNA has been isolated and ATR gene was sequenced with his request. Sequence of the patients ATR gene is provided below and the reference sequence`s accession number is NM_001184.4 .Patient`s sequence>patient ATRctgatcttgc tgccaaagca agccctgcag cttctgctct cattcgaact ttaggaaaac aattaaatgt caatcgtaga gagattttaa taaacaactt caaatatatt ttttctcatt tggtctgttc ttgttccaaa gatgaattag aacgtgccct tcattatctg aagaatgaaa cagaaattga actggggagc ctgttgagac aagatttcca aggattgcat aatgaattat tgctgcgtat tggagaacac tatcaacagg tttttaatgg tttgtcaata cttgcctcat ttgcatccag tgatgatcca tatcagggcc cgagagatat cgtatcacct gaactgatgg ctgattattt acaacccaaa ttgttgggca ttttggcttt ttttaacatg cagttactgagctctagtgt tggcattgaa gataagaaaa tggccttgaa cagtttgatg tctttgatga agttaatggg acccaaacat gtcagttctg tgagggtgaa gatgatgacc acactgagaa ctggccttcg attcaaggat gattttcctg aattgtgttg cagagcttgg gactgctttg ttcgctgcct ggatcatgct tgtctgggct cccttctcag tcatgtaata gtagctttgt tacctcttat acacatccag cctaaagaaa ctgcagctat cttccactac ctcataattga. Are there any changes in nucleic acid and amino acid sequences? If yes please explain the location(s) and change(s). (3 points)b. Does this change affect the protein domains? Explain in detail. (3 points)c. Based on your analysis in section (a) and (b), does this variation affect the protein function or not? Explain your answer. (2 points)d. Which program(s)/database(s) have you used to answer this question, list respectively. (1 point)