Elizabeth and Steven are pushing the cabinet to the right. Elizabeth applies 5 a force of 40 N and Steven exerts a force of 55 N. What is the Net Force? O 15 N Left 15 N Right 95 N Left O 95 N Right​

Answers

Answer 1

Answer:

95 N right

Explanation:

Given that,

Both Elizabeth and Steven pushes the cabinet to the right. Elizabeth applies 5 a force of 40 N and Steven exerts a force of 55 N.

As both forces are acting in same direction, they will add up. Net force is given by :

F = 40 N + 55 N

F = 95 N in right direction

Hence, the correct option is (d) "95 N right".


Related Questions

SCIENCE- help me please I have to turn this in tonight PLEASE.............

Answers

Answer:

Yes,if it has a large mass it will have a large weight Awnser (2)

Plsss helps plss

Extra 20 points

Answers

A is the answer I’m sure because I just took the test

Small-chain fatty acids can enter the bloodstream directly, but large-chain fatty acids must be packaged first before entering the . can be carbohydrate-, protein-, or fat-based. remove cholesterol from tissues and deliver it to the liver for use in bile or excretion. Linoleic acid and alpha-linolenic acid are considered , and must be obtained from the diet. is needed to help mix fats with watery fluids. Carriers that transport monoglycerides and fatty acids to intestinal cells are called . contains 6 to 8 fatty acids connected to sucrose, and cannot be broken down by digestive enzymes. A is a lipoprotein carrier that transports digested fat and other lipids through the lymph system.

Answers

Answer:

lymph

fat substitutes

high-density lipoproteins

essential fatty acids

emulsification (bile)

micelles

olestra

chylomicron

Explanation:

Short-chain fatty acids can be absorbed directly into the bloodstream by the intestine capillaries, while long-chain fatty acids are released into the tiny intestine. Fat substitutes are chemical compounds that have similar properties of fats and oils, with fewer calories than fat. High-density lipoproteins (HDL) are referred as "good" cholesterol because they transport cholesterol from other body parts back to the liver. The alpha-linolenic acid and linoleic acid correspond to omega-3 and omega-6 fatty acids, respectively, and they are essential fatty acids that need to be consumed in the human diet. Emulsification is a chemical process consisting of mixing two immiscible liquids to form a semistable mixture. Micelles are chemical structures formed by the agglomeration of mixed lipids and bile acids, which support the action of lipases for digesting lipids. Olestra is a fat substitute that can be used in low-calorie diets for weight control. Finally, chylomicrons are ultra low-density lipoproteins (ULDLs) composed of triglycerides, phospholipids, cholesterol and proteins. The ULDLs are produced by intestinal cells.

release energy to
2. Chemical reactions that take place in
carry out cell processes.

Answers

Answer:

Explanation:

All organisms require energy to complete tasks; metabolism is the set of the chemical reactions that release energy for cellular processes.hope it helps......

Rice, wheat, soybeans, and _______ are considered the four angiosperms that are responsible for early agriculture.

Answers

Answer:

Corn

Explanation:

I'm not 100% sure so lmk ig I'm right or wrong

Answer:corn

Ethylene

dormant

anther

stigma

fruit

temperature

Wind pollination required a great deal of excess pollen, just so some of it lands, by chance, in the right place. Animal pollination is more selective because animals pick pollen up and carry it directly to where it needs to be. Although there is still a chance that the pollen will be from the wrong plant species, plants can manipulate variations in animal behavior through the structures of their flowers, the time and season of flowering, or the rewards or attractive chemicals they produce to narrow the field of pollinators, and increase the chances of having exactly the right pollen put in exactly the right place.

Explanation:

3. Write the complimentary sequence of DNA for the following strand:
5'-AATTAGGAGCCCAGCTTTGCCGA-3'

Answers

The correct answer is TTAATCCTCGGGTCGAAACGGCT

This is because whenever you’re trying to find the complementary sequence of DNA, you basically switch which the listed base and it’s correspondent.

Adenine -> Thymine
Cytosine -> Guanine

Hope this helps!! :)

Charles Hillman, an associate professor at the University of Illinois, is conducting research into why children are better at problem-solving after exercise. He places 20 kids, approximately 10 years of age, on a treadmill for 20 minutes. Another group of 10-year-old kids sits in a chair for 20 minutes. Dr. Hillman then measures the brain wave activity of both groups. The group who exercised showed a 5% increase in the P3 waves, which occur during decision- making. What would need to be done in order to make this experimental outcome accepted in the scientific community? Group of answer choices More time would need to be allowed for the experiment. Other scientists would need to confirm the results by performing the same experiment. The same test would have to be done using a different type of exercise. Girls and boys would need to be tested separately and then together.

Answers

Answer:

Other scientists would need to confirm the results by performing the same experiment.

Explanation:

According to this question, an experiment was conducted by an associate professor, using 20kids, to discover why children are better at problem-solving after exercise. He arrived at a result that Children who exercised showed a 5% increase in the P3 waves, which occur during decision- making.

However, in order for this findings by Charles Hillman to be generally accepted and recognized in the scientific community, which is a connection of several scientists, the results need to be confirmed by performing the same tests or experiment.

Note that, an experiment becomes a scientific theory if it has undergone series of repeatable tests. One of the key features of scientific experiment is that it must be repeatable.

Which order shows the levels of organization from smallest to largest?
O cell organ tissue organ system organism O cell tissue organ organ system organism
O cell organ system organ tissue organism
O cell organ organ system SHAK tissue organism​

Answers

Answer:

Cell tissue organ to organ systems

...........

Answer:

Cell tissue organ to organ systems

hope this helps

Im crying because im so in a hurry help me fastas you can in this science question.

Answers

energy convention: Convection is the motion of a fluid driven by temperature differences across that fluid. When a fluid is heated, the region in closest contact with the heat source becomes less dense due to increased kinetic energy in the particles. Convection is one of the fundamental ways that heat is transferred

This is a timeline depicting the development of atomic ___________. What word should be used to fill in the blank? Support your choice with evidence. A) Law. At each interval on the timeline, scientists described the patterns they saw in both atomic and subatomic structure. Eliminate B) Law. Scientists used observation, experimentation, and mathematical models to explain atomic stricter and the behavior of subatomic particles. C) Hypothesis. Scientists conducted experiments at each interval. They made educated guesses regarding atomic structure and then experimented to support or rejected the hypotheses. D) Theory. At each interval on the timeline, scientists made observations and conducted experiments to explain how atoms and/or subatomic particles behaved in order to determine atomic structure.

Answers

Answer:

Subatomic particle, also called elementary particle, any of various self-contained units of matter or energy that are the fundamental constituents of all matter. Subatomic particles include electrons, the negatively charged, almost massless particles that nevertheless account for most of the size of the atom, and they include the heavier building blocks of the small but very dense nucleus of the atom, the positively charged protons and the electrically neutral neutrons. But these basic atomic components are by no means the only known subatomic particles. Protons and neutrons, for instance, are themselves made up of elementary particles called quarks, and the electron is only one member of a class of elementary

Explanation:

because it is

it's d lol

Theory. At each interval on the timeline, scientists made observations and conducted experiments to explain how atoms and/or subatomic particles behaved in order to determine atomic structure. Let's take one example: Rutherford's gold foil experiment. Based on observing the behavior of alpha particles directed at a gold foil screen, Rutherford determined that an atom consisted of mostly empty space, with all of its positive charge concentrated in its center in a very tiny volume, surrounded by a cloud of electrons. Yet, further experimentation eventually lead to another model and another theory of atomic structure.

why did europeans want to conquer the new world ?

Answers

Answer:

Europeans wanted to explore the world so that they could gain wealth. European rulers fought many wars and they were very expensive so they needed to find gold, silver and precious stones to pay for them.

Explanation:

Which organelles are found in plant cells but not in animal cells?

Answers

Answer:

Organelles that are found in plant cells, and not in animal cells, are chloroplasts, a call wall, specialized plastids, and a large central vacuole.

Hope you found this helpful <3

Answer:

cell wall and chloroplast

Explanation: hope this helps:)

Are fungi Producers or Consumers?

Answers

Answer:

Bacteria and fungi are actually decomposers. They eat decaying matter - dead plants and animals and in the process they break them down and decompose them.

Fungi it’s a decomposer because it decomposes the bodies of dead plants and animals.

Phosphorus is mainly stored in the

Answers

Answer:

Phosphorus is mainly stored in the  soil and rocks in the form of phosphate.

Explanation:

i hope this helps

If one strand of the DNA reads:
ATCCGCAT
What will the complementary strand be?

Answers

Answer:

in rna the strand would be    UAGGCGUA

G goes with C and A goes with U ( unless there is a T within the strand already then its an A that airs up with it )

Explanation:

but if its in DNA the strand will be     TAGGCGTA

G goes with C        T goes with A

Answer:

TAGGCGTA

Explanation: A with T: the purine adenine (A) always pairs with. the pyrimidine thymine (T) C with G: the pyrimidine cytosine (C) always pairs with. the purine guanine (G)

Commodity processors extract juice from oranges and
it in order to kill microbes and slow spoilage.

Answers

Answer:

Microbes

Explanation:

Climate is a global factor that produces

A. Earth’s unique ocean and atmosphere.
B. the shape and elevation of landmasses.
C. a wide range of environmental conditions that shape communities.
D. solar energy within the atmosphere.

Answers

Answer:

C. a wide range of enviromental conditions that shape communitites

Explanation:

Climate is a global factor that produces a wide range of environmental conditions that shape communities. Option C.

Climate as a global factor

Climate is a global factor that generates a wide range of environmental conditions, including temperature, precipitation patterns, humidity, wind patterns, and seasonal variations.

These environmental conditions play a crucial role in shaping the structure and dynamics of ecosystems and the distribution of organisms. Climate influences factors such as the types of vegetation, availability of water resources, and the adaptability and survival of various species.

It affects the composition and characteristics of communities and ecosystems, making it a key factor in ecological processes and biodiversity.

More on climate change can be found here: https://brainly.com/question/33588826

#SPJ6

In activity c, you explored how temperature affects the concentration of dissolved oxygen in a pond use the three data points you collected for the cold Pond to determine the mean dissolved oxygen of the cold pond

Answers

Answer:

Add the three data and divided by 3.

Explanation:

Temperature has a great affects on the concentration of dissolved oxygen in a pond because temperature is responsible for the presence of high amount of dissolved oxygen in water. At low temperature such as in winter season, the amount of dissolved oxygen in water is higher while in warm temperature such as in summer season, the concentration of dissolved oxygen is lower. So   for measuring the mean dissolved oxygen of the cold pond, you have to add the data and then divided by 3, you will get the average dissolved oxygen of the cold pond.

Describe a non-biological hierarchy that exists in everyday life and how it relates to a biological system.


Answers

Answer:

A non-biological hierarchy could be the way the military is organized, with the soldiers at the very bottom and the big commanders on top. (I don't know the specific names for each of them) This relates to a biological heirarchy since the smaller, sadly less important things are at the bottom, like atoms and soldiers, and each group of soldiers makes a regiment (which would be a molecule), then a battalion (which would be a cell), then so on. (I dont know the order of the groups but you can look it up)

Which of the following could be a sequence in the carbon cycle?

Answers

Answer:

plants take in carbon dioxide and produce glucose --> animals consume plants --> animals break down glucose and release carbon dioxide

Explanation:

The carbon cycle is the sequence through which carbon is cycled through ecosystems. The carbon cycle usually occurs in the following order:

First, plants take in carbon dioxide and convert it to glucose.

Then, animals consume plants and break down glucose through the process of respiration.

Finally, this process releases carbon dioxide back into the atmosphere, and the cycle continues.

Why is it beneficial for the earth to have both autotrophic and hypertrophic?

Answers

Because it will create balance on the earth. For example if there are only autotrophs there will be competition for nutritious and space for the roots to grow .Also for the heterotrophs, the harbivous will be hard for them to find plants to eats eventually it will lead to starvation then death and their death will affect carnivores because the organisms that they used to hunt are all dead now. So when there is a balance between autotrophs and heterotrophs they will help each other to survive.

What do paleontologists do when they uncover incomplete fossils

Answers

Answer:

Explanation:

Paleontologists are scientists that study the history/existence of past lives by collecting and examining fossils. They use these fossils to determine the history and age an organism has existed. Fossils are remains of dead organisms (plants and animals) which serve as evidence of past lives that have existed on earth in the past. They could include bone remains or footprint of this animals.

Fossils (from bones) are however mostly incomplete because they decompose before they are "stored naturally" by sediments which covers them. When scientists discover this incomplete fossils, they are compared (if there has been similar fossils discovered before then) and are stored and transferred to the lab for examination. This examination includes anatomical comparison (to determine relatedness with other fossils/organisms), carbon dating (to determine age) and data comparison (which includes location and type of soil and habitat).

What are some human interactions that are harming both the carbon and nitrogen cycles?

Answers

pollution is one of the options

what are some alternatives to plastic
What are some alternatives for plastic

Answers

Answer:

paper, like instead of plastic straws you could use paper ones instead

Explanation:

Glass

Reusable Shopping Bags

Plastic Additives

Milk Protein

Grape Waste

Liquid Wood

PCL Polyesters

PHA Polyesters

PLA Polyesters

Starch-based Polymers

Hope this helps!! <3

If a squirrel climbs a tree at 16m/s how many meters will it travel every hour ? ____ m/hr

Answers

Answer:

57600

Explanation:

16x60x60

Brainiest please :D

The distance travelled per hour by the squirrel as it climbs a tree at 16m/s is :  57600m/hr

Determine the distance travelled every hour

Given data :

velocity = 16m/s

To determine the distance travelled per hour

16 m * 60secs * 60 minutes

= 16 * 60 * 60

= 57600 m

Hence we can conclude that the The distance travelled per hour by the squirrel as it climbs a tree at 16m/s is :  57600m

Learn more about Velocity : https://brainly.com/question/4931057

#SPJ2

1 2 3 4 5 6
Chapter 2 (2.1) Study Guide
Directions: Answer the questions using your notes and study for them for the test along with
your worksheets. Make sure to submit your answers in google classroom before your block
begins.
1. Anything that has mass and volume
matter
2. The smallest functional unit of matter
3. An atom has 3 subatomic parts:
4.
carry a positive charge and are located in the
5. When two compounds are placed together and the result is something new, we know a
reaction has taken place.
6. Label the following examples as physical or chemical changes:
a. Burning paper
b. Nail rusting

Answers

Answer:

The smallest functional unit of matter: Atoms

An atom has 3 subatomic parts: Electrons, neutrons, and protons.

PROTONS carry a positive charge and are located in the: center of the nucleus in the atom.

Explanation:

A student wants to create a liquid volcano. The student observes bubbles in the soft drink prior to opening it. The student first proceeds to open the soft drink bottle and place it on the floor. Next the student drops candy tablets into the drink using a rolled piece of paper, so that the tablets are able to fall into the drink continuously. The student notices a very powerful reaction as the drink fizzes and starts to bubble. In this scenario, what would be the catalyst ?

Answers

Answer: the candy tablets being added to the drink

Explanation: i’m on the test right now and that’s what seems more logical

Answer:

A student wants to create a liquid volcano. The student observes bubbles in the soft drink prior to opening it. The student first proceeds to open the soft drink bottle and place it on the floor. Next the student drops candy tablets into the drink using a rolled piece of paper, so that the tablets are able to fall into the drink continuously. The student notices a very powerful reaction as the drink fizzes and starts to bubble. In this scenario, what would be the catalyst ?

A: The candy tablets being added to the drink

Plz help I will mark you brainlist plz ​

Answers

Answer:

ISOTOPES

the same number of protons

but difference numbers of neutrons

IONS

because they have lost or gained one or more electrons

Answer:

atoms of the same element have same proton number but different nucleon number I hope this help u if u want more ask me

If a carbon atom is bonded to two hydrogen atoms and two carbon atoms, what type of bond must exist between the
carbon atoms?
O single
O double
O triple
O quadruple

Answers

the answer is A. single .

Who was the first person to see cells under the microscope and give them name a Robert Hooke b Theodor Schwann c Anton van Leeuwenhoek d Matthias Schleiden

Answers

Answer:

a) Robert Hooke

Explanation:

The cell was first discovered by Robert Hooke in 1665, which can be found to be described in his book Micrographia. In this book, he gave 60 'observations' in detail of various objects under a coarse, compound microscope.

The first person to observe the cell under the microscope is Robert Hooke, who is present in Option a. Robert Hooke is the person who first observed cork cells under the microscope and gave them a name. Option a is correct

What is a cell?

In the early stages of the earth, cells were not as developed as those of today's eukaryotes; they had RNA as genetic material, and later by evolution, today's eukaryotic cells developed. Those RNA-containing cells were extremely susceptible to mutation, whereas today's DNA-containing cells are not.

The eukaryotic cell contains numerous organelles that perform various functions, such as the lysosome, which degrades pathogens, the chloroplast of plants, which perform photosynthetic reactions, the nucleus of eukaryotic cells, which conserves DNA, and the mitochondria, which generate energy through cellular activities.

Hence, the first person to observe the cell under the microscope is Robert Hooke and gave them a name, who is present in Option a.

Learn more about the cell here.

https://brainly.com/question/12129097

#SPJ5

Other Questions
What is the name given to the group of 9 high school students who were among the firstblack students in America to attend a white school in the South? How many cubic centimeters are in a cube that is 11.1 inches on a side?*use dimensional analysis to solve this problem* Which of the genotypes below would be heterozygous? Choose all that are. What is the median of the following data set? 24, 18, 32, 48, 90 What was the final cause of the French Revolution? Scientists have observed that when air pollution is significantly reduced, the frequency of the melanic form of peppered moths:______. After Spain claimed parts of the Americas, other countries beganclaiming land in the Americas too because they - A-believed learning about Native American culture was importantB-did not want all the Natives in the Americas to become CatholicC-did not want people in the New World to only speak SpanishD-wanted to become wealthier too Ebony is writing an argument that opposes the use of mobile phones while driving. She wants her introduction to have a strong impact on the reader. How should Ebony begin her introduction? A. with a plea to the reader to turn off mobile devices before getting into the car B. with a personal story about a friend who refuses to put away her phone while riding in the car C. with a quote from a traffic-safety expert on the number of texting-related deaths each year D. with a brief retelling of a driver's last minutes before being killed by someone who was texting and driving Ana and Jesse are scuba diving. Ana is 35 meters below the surface of the water, and Jesse is 8 meters directly below her. What is Jesse's current position relative to the surface of the water? Is 0.72 repeating irrational or rational? which formula defines the sequence f(1)=2, f(2)=6, f(3)= 10, f(4)= 14,f(5)=18 AP psychologyHow did Ernst weber contribute to psychology? I found that he did the Two point threshold and the just noticeable difference but how is it connected to psychology? Now that you have selected the cultural environment, you must predict what the effects of these changes on gerlach's microenvironment might be. select the outcome you see as most likely. select an option from the choices below and click submit. Determine the truth value of the given conditional statement.Given: If 3 is an even number, then 5 + 3 = 8.O A true statement implies a true statement, so the conditional statement is true.VXO A true statement implies a false statement, so the conditional statement is true.O A false statement implies a true statement, so the conditional statement is true.O A false statement implies a true statement, so the conditional statement is false.IntroDone I NEED HELP ASAPP!!! Which type of error occurred in the following lines of code? >>> print("Good Morning")SyntaxError: unexpected indentlogical errorreserved word errorexceptionsyntax error Refer to the article "Harun al-Rashid & One Thousand and One Nights." How does the passage develop the idea that Scheherazade is a clever wife? She uses her stories to keep herself alive. She is a gifted storyteller. She tells stories on many subjects. She creates suspense with her stories. There are two ways that an object can get in motion. What are they?You may use the following sentence frame:An object can get in motion by a ____ or a ____. In 35 complete sentences, thoroughly explain how your protagonist changes from the beginning of the story to the end in your Module One short story? Provide at least two specific details from the text to show how the protagonist changes from the beginning of the story to the end.The story is "The Rule of the Game" by Amy Tan How many valence electrons does the element with the following electron configuration have? 1s22s22p63s23p64s23d104p4