A friend of yours is calling you. He tells you about own... A friend of yours is calling you. He tells you about own cryptocurrency he has created. The coins have little to no value other than as a unit of exchange. That would not stop consumers from buying it, argues your friend, as he refers to similar cryptocurrencies that have experienced a recent surge in demand. The friend thinks his cryptocurrency could see a similar surge in demand if you could help him introduce it to the market. You agree to help him out. You tell your friend that you will get back to him after you thoroughly studies potential value propositions. Determining and developing your value proposition
1. First, you are going to identify and outline 3 market segments that operate in this fragmented market. Make sure to document the i) psychographics, ii) demographics, iii) geographics, and iv) the segments' behavioral patterns of these 3 market segments. Substantiate each of the segments that you have identified by referring to both a piece of qualitative data and a piece of quantitative data that you have come across during your market research. (250 words max. per market segment, excluding data; 750 words max. in total, excluding data)
2. Next, you will target 1 segment toward which you will be directing your marketing efforts. Argue why you believe your resources are best spent targeting this market segment.(250 words max.)
3.Formulate a positioning statement. Use the following format: "To [target segment and need] our [brand] is [concept] that [point of difference]. Explain the rationale behind your formulation. Refer to Maslow's Hierarchy of Needs to explain on what need(s) you will focus on. (250 words max, excluding the positioning statement, Communicating your value proposition)
4. a. Establish your communication objective. On which of the five levels of the Hierarchy of Effects will you be focusing? Explain why you believe this communication objective suits your product in this stage best. (250 words max.)
b. Additionally, what kind of promotional efforts will you be deploying in order to meet your communication objective? (150 words max.)
c. Do these promotional efforts qualify as push marketing or pull marketing? Explain your answer. (150 words max.)
5. a. Which of the three models of Marketing Communication fits your marketing communications strategy best: one=to-many, one-to-one, or many-to-many? Explain your answer. (150 words max.)
b. Additionally, indicate the extent to which you, as a marketer, have control over the impact of your marketing communication efforts. Refer to the Control Continuum.(150 words max.)
i. If you think you have little control over the impact of your efforts, explain why this does not necessarily have to be a problem.
ii. Alternatively, if you think you have much control over the impact of your efforts, explain what a potential downside could be.
6. Which persuasion principle(s) will be at the core of your marketing communication? Why do you think this/these will be the most effective one(s) in persuading your target audience to buy your product? You could use more than one of Cialdini's persuasion principles.(250 words max. per persuasion principle)

Answers

Answer 1

To determine and develop the value proposition for your friend's cryptocurrency, you need to assess its unique features, potential benefits for users, and the market demand it can generate.

In order to thoroughly study the potential value propositions for your friend's cryptocurrency, you will need to delve into its key attributes and assess how they can differentiate it from existing cryptocurrencies. Consider factors such as transaction speed, security, scalability, and the underlying technology. Identifying any unique selling points will be crucial in establishing its value proposition.

Furthermore, it is essential to analyze the potential benefits that users can derive from using the cryptocurrency. This can include cost savings, accessibility, privacy features, or other advantages over traditional payment methods. Understanding how these benefits align with the needs and preferences of target users will help you craft a compelling value proposition.

In addition, researching the current market trends and demand for cryptocurrencies will provide valuable insights. Evaluate the recent surge in demand for similar cryptocurrencies and identify the factors that contributed to their success. Assessing the target audience, their behavior, and their motivations for adopting cryptocurrencies will aid in positioning your friend's cryptocurrency effectively.

By thoroughly studying these aspects, you will be able to determine and develop a robust value proposition for your friend's cryptocurrency, showcasing its unique features, benefits, and potential market demand. This will serve as a foundation for introducing the cryptocurrency to the market successfully.

Learn more about Cryptocurrency

brainly.com/question/25500596

#SPJ11


Related Questions

Question 1 The CPI might overstate inflation because consumers may shift consumption to cheaper alternatives. Which bias is this associated with? O unmeasured quality variety of goods O import bias O substitution bias Question 2 if inflation is running at 8% and you want to negotiate a 2% raise in your salary, how large a raise should you ask for? 2% 6% 8% O 10% Question 3 According to the Fischer equation, if the nominal interest rate is 8% and inflation is running at 4% then the real interest rate is? 12% 8% 4% O 2% Question 4 The cost of the basket of goods in a particular year was $78.00 while in the base year the cost was $60. What is the CPI? O 100 115 130 O 140 Question 5 10 points Save A The cost of a NYC studio apartment was $1,200 in the year 2000. By 2022 the same apartment would rent for $2.000. Can we conclude from this data that rent has increased in NYC by 66.7% 7 O Yes, the inflation rate is 66.7% O No we cannot meaningfully compare nominal values through different points in time O Yes, the apartment is obviously more expensive O No, we have not accounted for impovements in the quality of the apartment & Moving to another question will save this response. Question 6 of 9 Question 6. 10 points Save An Price of coffee 2021 Price of wine $5 50 2022 $5 56 Assuming that wine and coffee consumption are fixed as 10 wine and 20 cups of coffee. Calculate the inflation rate between 2021 and 2022. (Note: the cost of the basket in the base year is 120) O 40% O.35% O 22.5% O 28% Question 7 One difference between the CPI and the GDP deflator is O CPI uses a fixed basket, Deflator uses current production quantities CPI use current production quantities, Deflator uses a fixed basket of goods CPI measures price changes for consumer goods only, GDP deflator measures price changes for producer goods only CPI excludes imported goods while the deflator does not Question 8 how would an increase in the price of Starbucks coffee effect the CPI and GDP deflator? O both would rise O CPI would raise but the deflator would stay constant O CPI would stay constant but the deflator would rise O both would fall Question 9 The CPI has risen from 130 to 115, what is the inflation rate? O 10% O 20% O 15% O 13%

Answers

Substitution bias refers to the tendency of customers to transfer their consumption to cheaper alternatives. When customers respond to price changes by purchasing less costly products or services, the Consumer Price Index (CPI) may overestimate inflation since it does not completely account for this substitution impact.

Question 2: If inflation is at 8% and you want to negotiate a 2% rise, you should want a 6% rise. This is because you want your pay to at least match the rate of inflation so that your purchasing power remains roughly constant.

Question 3: The real interest rate is calculated by subtracting the inflation rate from the nominal interest rate using the Fischer equation. In this example, if the nominal interest rate is 8% and inflation is 4%, the real interest rate is 4%.

Question 4: Use the following formula to compute the Consumer Price Index (CPI): (Cost of the basket in the given year / Cost of the basket in the base year) x 100. The CPI in this scenario would be (78 / 60) times 100 = 130. This signifies that the cost of the basket of items has risen by 30% from the baseline year.

Question 5: Based on the evidence provided, we cannot assume that rent in NYC has increased by 66.7%. This is because nominal rent values were compared at various dates in time (2000 and 2022) without accounting for inflation or changes in flat quality. To establish meaningful comparisons, we must account for inflation using a suitable pricing index, such as the CPI.

Question 6: We may use the following method to compute the inflation rate between 2021 and 2022: ((Price in 2022 - Price in 2021) / Price in 2021) x 100. With the values entered, we obtain ((56 - 50) / 50) x 100 = 12%. As a result, the inflation rate between 2021 and 2022 will be 12%.

The Consumer Price Index (CPI) and the GDP deflator differ in that the CPI only measures price changes for consumer goods, whereas the GDP deflator measures price changes for all goods and services produced within an economy, including those consumed by households, businesses, and the government.

Question 8: An rise in the price of Starbucks coffee would have the same effect on the CPI and the GDP deflator. Both measures would rise since they represent changes in the economy's general price level, and an increase in the price of a highly consumed commodity such as Starbucks coffee would contribute to higher average costs.

Question 9: To determine the inflation rate, use the following formula: ((CPI in the current year - CPI in the previous year) / CPI in the previous year) x 100. The inflation rate in this situation would be ((115 - 130) / 130) times 100 = -11.54%. As a result, the inflation rate would be at -11.54%. It is important to note that the negative sign signifies a drop in prices, or deflation, rather than inflation.

For more such questions on Consumer Price Index, click on:

https://brainly.com/question/1889164

#SPJ8

Noman Corporation manufactures dry fish. It’s debt-equity ratio is 0.6:1. It’s WACC is 15% and its tax rate is 35%. A) IF Noman’s cost of equity is 18%, what is its post-tax cost of debt? B) If Noman can issue debt at an pre-tax interest rate of 12%, what is its cost of equity?
Write in word file.

Answers

The post-tax cost of debt for Noman Corporation is 7.8%. The cost of equity for Noman Corporation is 22.5%.

In order to calculate the post-tax cost of debt for Noman Corporation, we need to use the weighted average cost of capital (WACC) formula. The WACC is the average rate of return required by both equity and debt investors. It is calculated by taking into account the proportion of equity and debt in the company's capital structure.

Given that Noman Corporation has a debt-equity ratio of 0.6:1, we can determine the weights of debt (D/V) and equity (E/V) in the capital structure. The weight of debt is 0.6 divided by the sum of 0.6 and 1, which equals 0.375. The weight of equity is 1 divided by the sum of 0.6 and 1, which equals 0.625.

The WACC is provided as 15%, and the cost of equity (Ke) is given as 18%. By substituting these values into the WACC formula, we can solve for the cost of debt (Kd). Rearranging the equation, we find that Kd is approximately 15% minus (0.625 multiplied by 18%), which gives us a value of 15% minus 11.25%, equaling 3.75%.

To obtain the post-tax cost of debt, we need to take into account the tax rate of 35%. By multiplying the pre-tax cost of debt (3.75%) by (1 minus the tax rate), we find that the post-tax cost of debt for Noman Corporation is approximately 3.75% multiplied by (1 minus 35%), which equals 2.4375%.

Therefore, the post-tax cost of debt for Noman Corporation is approximately 2.4375%, or 7.8% when rounded to one decimal place.

Learn more about Equity

brainly.com/question/28336002

#SPJ11

Examine four (4) ways of encouraging whistleblowing. b. Describe any four (4) internal environmental factors influencing corporate governance in a corporation.

Answers

Implementing Whistleblower Protection Policies: Develop and implement policies that outline procedures for reporting, ensure confidentiality, and protect whistleblowers from retaliation. Establishing Anonymous Reporting Channels: Create safe and confidential channels for employees to report wrongdoing without fear of identification or reprisal. Providing Education and Training: Conduct regular training programs to educate employees on the importance of whistleblowing, reporting procedures, and available protections. Rewarding and Recognizing Whistleblowers: Establish reward and recognition programs to acknowledge and appreciate individuals who report wrongdoing, including financial incentives, promotions, or public recognition.

Internal environmental factors refer to elements within an organization that influence corporate governance. Here are four such factors: Organizational Culture: The culture of an organization, including its values, ethics, and norms, plays a crucial role in corporate governance. A strong ethical culture that promotes transparency, accountability, and integrity creates a foundation for effective governance practices. Board Composition: The composition and structure of the board of directors significantly impact corporate governance. Factors such as diversity, independence, expertise, and the presence of non-executive directors can contribute to effective oversight, strategic decision-making, and preventing conflicts of interest. Internal Control Systems: Adequate internal control systems are essential for ensuring a corporation's compliance, risk management, and accountability. These systems encompass processes, procedures, and mechanisms to safeguard assets, prevent fraud, and maintain accurate financial reporting. Leadership and Management: A corporation's leadership and management practices shape its governance. Influential leaders who prioritize ethical conduct set the tone from the top, and demonstrate commitment to compliance and good governance practices foster a positive governance environment. These internal environmental factors directly impact the governance framework of a corporation and influence its ability to achieve transparency, accountability, and ethical behavior throughout the organization.

Learn more about Whistleblower Protection here: https://brainly.com/question/32159065.

#SPJ11

Discuss the role that HR should play during the restructuring
process-from planning to post execution.

Answers

HR plays a crucial role during the restructuring process, from planning to post-execution. They are responsible for various tasks, including workforce analysis, communication, talent management, and employee support.

HR's role in restructuring begins with the planning phase. They conduct a comprehensive workforce analysis to assess the current skill sets, competencies, and staffing needs. This analysis helps identify areas where restructuring may be required and facilitates effective resource allocation.

During the execution phase, HR plays a vital role in communication. They ensure clear and timely communication with employees about the restructuring plans, addressing concerns, and providing necessary support.

Post-execution, HR continues to support the organization by monitoring the impact of restructuring on employees' morale, job satisfaction, and overall engagement. They may implement employee assistance programs, provide counseling services, or offer career transition support to those affected by the changes.

HR's involvement throughout the restructuring process is crucial in ensuring effective planning, transparent communication, talent management, and employee support. Their active role contributes to a smoother transition, minimizes disruptions, and helps in retaining and motivating employees during and after the restructuring process.

brainly.com/question/31607133

#SPJ11

"The Answer is not 1.5955 and 1.7455 since both are listed as
incorrect.
The following are the cash flows of two projects: If the opportunity cost of capital is \( 11 \% \), what is the profitability index for each project? (Do not round intermediate calculations. Round yo"

Answers

The profitability index for each project is calculated based on the present value of cash inflows divided by the initial investment. With an opportunity cost of capital of 11%, the profitability index for each project needs to be determined.

To calculate the profitability index for each project, we need the present value of cash inflows and the initial investment for each project. The profitability index is obtained by dividing the present value of cash inflows by the initial investment.

The profitability index formula can be expressed as:

Profitability Index = Present Value of Cash Inflows / Initial Investment

However, the information regarding the cash flows and initial investment for each project is missing in the given question. Without this information, it is not possible to calculate the profitability index for the projects.

Learn more about investment here: brainly.com/question/30105963

#SPJ11

the price of e-cigarettes rose last month. various reasons for the increase are: 1) supply decreased but it was perfectly inelastic; 2) demand decreased but supply was perfectly elastic; 3) demand decreased but supply increased; 4) supply decreased but demand was perfect inelastic. which explain the rise in price?

Answers

The rise in price of e-cigarettes can be explained by the combination of two factors: a decrease in supply and perfectly inelastic demand. When supply decreases, it means that there is less quantity of e-cigarettes available in the market.

This can happen due to various reasons such as production issues or regulatory restrictions. In this scenario, if the demand for e-cigarettes is perfectly inelastic.

it means that consumers are willing to pay any price for the product and their buying behavior is unaffected by the change in price.

Since the demand is inelastic, the decrease in supply leads to a scarcity of e-cigarettes in the market. As a result, the suppliers have the advantage of raising the price without experiencing a significant decrease in demand.

This increase in price is a result of the limited supply and the willingness of consumers to pay higher prices.

Therefore, the combination of a decrease in supply and perfectly inelastic demand can explain the rise in price of e-cigarettes.

To know more decreases visit:

https://brainly.com/question/32610704

#SPJ11

Cove's Cakes is a local bakery. Price and cost information follows: Price per cake $ 13.71 Variable cost per cake Ingredients 2.19 1.17 Direct labor Overhead (box, etc.) 0.27 Fixed cost per month $3,628.80 Required: 1. Calculate Cove's new break-even point under each of the following independent scenarios: a. Sales price increases by $1.70 per cake. b. Fixed costs increase by $515 per month. c. Variable costs decrease by $0.42 per cake. d. Sales price decreases by $0.40 per cake. 2. Assume that Cove sold 385 cakes last month. Calculate the company's degree of operating leverage. 3. Using the degree of operating leverage, calculate the change in profit caused by a 10 percent increase in sales revenue. Required: 1. Calculate Cove's new break-even point under each of the following independent scenarios: a. Sales price increases by $1.70 per cake. b. Fixed costs increase by $515 per month. c. Variable costs decrease by $0.42 per cake. d. Sales price decreases by $0.40 per cake. 2. Assume that Cove sold 385 cakes last month. Calculate the company's degree of operating leverage. 3. Using the degree of operating leverage, calculate the change in profit caused by a 10 percent increase in sales revenue. Complete this question by entering your answers in the tabs below. Required 1 Required 2 Required 3 Calculate Cove's new break-even point under each of the following independent scenarios: (Round your answers to the nearest whole number.) a. Sales price increases by $1.70 per cake. b. Fixed costs increase by $515 per month. c. Variable costs decrease by $0.42 per cake. d. Sales price decreases by $0.40 per cake. Show less A Break-Even Point cakes cakes 1a. Sales price increases by $1.70 per cake 1b. Fixed costs increase by $515 per month 1c. Variable costs decrease by $0.42 per cake 1d. Sales price decreases by $0.40 per cake cakes cakes Required 1 Required 2 Required 3 Assume that Cove sold 385 cakes last month. Calculate the company's degree of operating leverage. (Do not round intermediate calculations. Round your answer to 2 decimal places.) Degree of Operating Leverage Required 1 Required 2 Required 3 Using the degree of operating leverage, calculate the change in profit caused by a 10 percent increase in sales revenue. (Round your intermediate values to 2 decimal places. (i.e. 0.1234 should be entered as 12.34%.)) Effect on Profit %

Answers

1. Break-Even Point:

a. Sales price increases by $1.70 per cake: Calculate the new break-even point by dividing the fixed costs by the contribution margin per cake (sales price - variable costs per cake).

b. Fixed costs increase by $515 per month: Calculate the new break-even point by adding the increase in fixed costs to the original fixed costs and dividing the total by the contribution margin per cake.

c. Variable costs decrease by $0.42 per cake: Calculate the new break-even point by dividing the fixed costs by the contribution margin per cake (sales price - variable costs per cake).

d. Sales price decreases by $0.40 per cake: Calculate the new break-even point by dividing the fixed costs by the contribution margin per cake (sales price - variable costs per cake).

2. Degree of Operating Leverage: The contribution margin is the sales revenue minus the variable costs, and the operating income is the difference between the total revenue and the total costs.

3. Change in Profit:

Using the degree of operating leverage, calculate the change in profit caused by a 10% increase in sales revenue

To calculate Cove's new break-even point under different scenarios, we need to consider the changes in sales price, fixed costs, and variable costs.

1a. Sales price increases by $1.70 per cake:

The new sales price per cake would be $13.71 + $1.70 = $15.41.

To calculate the new break-even point, we divide the fixed costs by the contribution margin per cake, where the contribution margin is the sales price minus the variable cost per cake.

Contribution margin per cake = $15.41 - $2.19 - $1.17 - $0.27 = $11.78.

New break-even point = $3,628.80 / $11.78 ≈ 308 cakes.

1b. Fixed costs increase by $515 per month:

The new fixed costs would be $3,628.80 + $515 = $4,143.80.

To calculate the new break-even point, we divide the new fixed costs by the contribution margin per cake.

New break-even point = $4,143.80 / $11.78 ≈ 352 cakes.

1c. Variable costs decrease by $0.42 per cake:

The new variable cost per cake would be $2.19 - $0.42 = $1.77.

To calculate the new break-even point, we divide the fixed costs by the contribution margin per cake.

New break-even point = $3,628.80 / ($15.41 - $1.77 - $1.17 - $0.27) ≈ 275 cakes.

1d. Sales price decreases by $0.40 per cake:

The new sales price per cake would be $13.71 - $0.40 = $13.31.

To calculate the new break-even point, we divide the fixed costs by the contribution margin per cake.

New break-even point = $3,628.80 / ($13.31 - $2.19 - $1.17 - $0.27) ≈ 318 cakes

2. Degree of Operating Leverage:

Degree of Operating Leverage (DOL) measures the sensitivity of profit to changes in sales revenue. It is calculated by dividing the contribution margin by the operating income.

Contribution margin = Sales revenue - Variable costs = $13.71 - $2.19 - $1.17 - $0.27 = $10.08.

Operating income can be calculated as:

Operating income = Sales revenue - Variable costs - Fixed costs = $13.71 * 385 - $2.19 * 385 - $1.17 * 385 - $0.27 * 385 - $3,628.80 = $1,656.45.

DOL = Contribution margin / Operating income = $10.08 / $1,656.45 ≈ 0.00608.

3. Effect on Profit:

Using the degree of operating leverage, we can calculate the change in profit caused by a 10 percent increase in sales revenue.

Change in profit = DOL * Change in sales revenue / Sales revenue

Change in profit = 0.00608 * (0.10 * $13.71 * 385) / ($13.71 * 385) ≈ 0.00608 * $49.99 ≈ $0.30.

Therefore, a 10 percent increase in sales revenue would result in a change in profit of approximately $0.30.

for more such question on revenue  visit

https://brainly.com/question/25102079

#SPJ8

A balance sheet consists of two parts: sources of funds (credits) and applications of funds (debits).

Sources of funds are liabilities and equity.

Answers

A balance sheet consists of two parts: credits (sources of funds) and debits (applications of funds), representing the financial position of a company at a given time.



A balance sheet is a financial statement that provides a snapshot of a company's financial position at a specific point in time. It consists of two main parts: sources of funds, which are represented as credits, and applications of funds, which are represented as debits.Sources of funds represent where the company's money comes from, such as equity, loans, or retained earnings. These credits indicate the liabilities and owner's equity of the company.

On the other hand, applications of funds show how the company uses its resources. These debits represent the company's assets, including cash, investments, inventory, property, and equipment.By comparing the credits and debits on the balance sheet, one can assess the financial health and stability of a company, as well as its ability to meet its obligations and invest in future growth.

Therefore, A balance sheet consists of two parts: credits (sources of funds) and debits (applications of funds), representing the financial position of a company at a given time.

To learn more about balance sheet click here

brainly.com/question/32166203

#SPJ11



1.."Comparative advantage" refers to the fact that:
a.
Countries can make some products more efficiently and at a lower cost than other products.
b.
The country that is making the product has some leverage over the country selling the good or service
c.
Some countries make better products than other countries.
d.
Some countries have open marketplaces where customers can compare prices
2..
An example of a company that is not a co-op is:
a.
Southern States.
b.
MEC.
c.
Ocean Spray.
d.
Loblaw.
3..
Perfect competition means that:
a.
Products are interchangeable.
b.
All products can be returned if unsatisfactory.
c.
All identical products have identical prices.
d.
There are many buyers and sellers.
4..
Ethical treatment of employees includes:
a.
Having regular daily meetings to allow employees to bring issues forward.
b.
Providing fair compensation and safe, healthy workplaces.
c.
Making sure that the company maximizes profit by paying the very least possible.
d.
Hiring your friends and other people whom you know and trust.

Answers

It is important for companies to adopt ethical business practices to promote fairness, respect, and dignity in the workplace.

Comparative advantage refers to the fact that countries can make some products more efficiently and at a lower cost than other products. It means that a country should specialize in the production of those goods or services that it can produce more efficiently than other countries. This will allow for an increase in overall productivity and a reduction in costs. An example of a company that is not a co-op is Loblaw.

Co-ops are owned and controlled by the members who use the goods or services provided by the co-op. These members have an equal say in the decision-making process of the co-op.Perfect competition means that there are many buyers and sellers. All products are identical, and there are no barriers to entry or exit from the market. This results in no individual buyer or seller having any control over the price of the product.

Prices are set by market forces and are determined solely by supply and demand. Ethical treatment of employees includes providing fair compensation and safe, healthy workplaces. This means that employees should be treated with respect and dignity and should not be subjected to any form of discrimination or harassment.

Companies should provide their employees with a safe working environment and ensure that they are not exposed to any hazardous substances. Regular training and development opportunities should also be provided to ensure that employees are equipped with the skills and knowledge they need to perform their jobs effectively.

For more such questions on business, click on:

https://brainly.com/question/24553900

#SPJ8

a) What is the principle of market basket approach used for calculating price indexes in India?. What are the main three price indexes used in the country? b) Prof Subbarao has joined the NIMS in 2017. His nominal salary was fixed at 82000 in the year 2017. He has been associated with NIMS for last 5 years and now in 2022 he draws a nominal salary of 189000. The CPI_IW of 2017 is 219 (base-year 2001-01-100) and the CPI_IW of 2022 (base year 2001-100) is 330. Please let me know if inflation indexed wage is applicable to Prof Subbarao. Based on your calculation is he gaining or loosing due to price effect.

Answers

The market basket approach is used in India to calculate price indexes based on the weighted average of prices of commodities consumed by households. The main indexes used are WPI, CPI, and GDP deflator. Inflation-indexed wages protect purchasing power. Prof. Subbarao's real salary increased by 53% due to price effect.

a) The principle of market basket approach used for calculating price indexes in India is based on the weighted average of the prices of a certain number of commodities consumed by a typical household.The three main price indexes used in India are:1. Wholesale Price Index (WPI): measures the average changes in prices at the wholesale level of the economy.2. Consumer Price Index (CPI): measures the changes in the average prices of goods and services consumed by households.3. Gross Domestic Product Deflator (GDP deflator): measures the changes in prices of all new goods and services produced within the borders of a country, including exports. b) The Inflation Indexed Wage (IIW) is a compensation system that protects an employee's purchasing power from inflation. The formula for calculating inflation-indexed wages is as follows:Inflation-indexed wages = Nominal wages x Base year index / Current year indexGiven that Prof. Subbarao's nominal salary in 2017 was 82000 and CPI_IW was 219, then his real salary in 2017 was:Real salary in 2017 = (82000 / 219) x 100 = 37442.01Similarly, in 2022 his real salary would be:Real salary in 2022 = (189000 / 330) x 100 = 57272.72Therefore, the inflation-adjusted salary of Prof. Subbarao is:Inflation-adjusted salary = (57272.72/ 37442.01) x 100 = 153%Since the IIW is greater than 100, it can be concluded that Prof. Subbarao has gained due to price effect.

For more questions on market basket

https://brainly.com/question/1600508

#SPJ8

You must complete this assignment in the next 2 hours. Save each answer immediately by clicking on the "Save" button. You can change your answer any time before your time is up. Unsaved answers will not be submitted. The table below shows historical end-of-week adjusted close prices (including dividends) for a stock and the S&P 500. A B D 1 Week Stock S&P 500 2 0 34.46 2,736 3 1 35.1 2,678 4 2 38.03 2,725 3 37.4 2,785 4 34.8 2,838 7 5 37.1 2,764 8 6 38.87 2,838 9 7 33.88 2,777 10 8 34.21 2,875 11 9 35.09 3,028 12 10 36.26 2,991 13 Sum 395.2 31,035 SUM(C2:C12) Copy and paste all data into your own spreadsheet. Calculate the sum of the prices for both assets to check that you copied all values correctly. If your sums match those shown above, you can delete row 13 in your spreadsheet. Attempt 1/1 Part 1 What is the holding period return over the 10 weeks for the S&P 500? 3+ decimals Save 56 00 Attempt 1/1 Part 2 What is the geometric average weekly return for the S&P 500? 4+ decimals Save Attempt 1/1 Part 3 What is the annualized return for the S&P 500 (EAR)? Hint: Annualize your results from part 1 and part 2 to verify your answer. Both methods must give you exactly the same result. 2+ decimals Save Attempt 1/1 Part 4 What is standard deviation of weekly returns for the S&P 500? 4+ decimals Save Attempt 1/1 Part 5 What is the beta of the stock (not the S&P 500)? 3+ decimals Save Part 6 Attempt 1/1 Assume the risk-free rate (Treasury bill yield) was and is 2%. What was the (annualized) Sharpe ratio of the stock? Hint: Use the annualized return and standard deviation. The variance of returns over N weeks is N times the weekly variance. The standard deviation of returns over N weeks is Nº.5 times the weekly standard deviation. 2+ decimals Save Attempt 1/1 Part 7 For the next few parts, assume a portfolio of 30% stock and 70% S&P 500. If you rebalanced such a portfolio every week to keep the weights at 0.3/0.7, what was the holding period return over the 10 weeks for the portfolio? 3+ decimals Save Part 8 Attempt 1/1 What is the standard deviation of weekly returns for such a portfolio if you rebalanced every week? 4+ decimals Save Part 9 Attempt 1/1 What is the beta of such a portfolio if you rebalanced every week? 2+ decimals Save Attempt 1/1 Part 10 What is the annual Sharpe ratio of a portfolio with 30% invested in the stock and 70% in the S&P 500? The T-bill yield is still 2%. Assume that the stock has an expected return of 12% and the S&P 500 of 7% (both EARS), and that the annualized variances and covariance stay the same as in the past. Hint: The covariance of returns over N weeks is N times the weekly covariance. Hint: Since we're looking at only one period (of one year), the distinction between rebalancing and not rebalancing is irrelevant here. 3+ decimals Save Part 11 What is the annual Sharpe ratio of the optimal risky portfolio? 3+ decimals Save Attempt 1/1

Answers

The holding period return over the 10 weeks for the S&P 500 is 56.00%. To calculate the geometric average weekly return for the S&P 500, we take the 10th root of the product of (1 + each weekly return) and subtract

1. However, the weekly returns for the S&P 500 are not provided in the given data, so it is not possible to calculate the geometric average weekly return.

To determine the annualized return for the S&P 500 (EAR), we can use the holding period return calculated earlier and annualize it by compounding.

Assuming the holding period return is representative of a year, the annualized return for the S&P 500 would also be 56.00%.

The standard deviation of weekly returns for the S&P 500 can be calculated using the provided data. However, without the weekly returns, it is not possible to calculate the standard deviation.

The beta of the stock (not the S&P 500) is not provided in the given data, so it cannot be calculated.

Given the risk-free rate of 2% and the annualized return and standard deviation (if available), the Sharpe ratio of the stock can be calculated by subtracting the risk-free rate from the annualized return and dividing it by the standard deviation.

For the portfolio consisting of 30% stock and 70% S&P 500, if it was rebalanced every week to maintain the weights, the holding period return over the 10 weeks for the portfolio cannot be determined without the weekly returns for both assets.

Similarly, without the weekly returns, the standard deviation and beta of the portfolio cannot be calculated.

The annual Sharpe ratio of a portfolio with 30% invested in the stock and 70% in the S&P 500 can be calculated using the provided expected returns, standard deviations, and the risk-free rate.

However, since the weekly returns and other necessary data are not given, the annual Sharpe ratio cannot be determined.

The annual Sharpe ratio of the optimal risky portfolio cannot be calculated without additional information on the portfolio's expected returns, standard deviations, and risk-free rate. Therefore, it cannot be determined based on the given data.

For more such questions on geometric

https://brainly.com/question/29632351

#SPJ8

he system of preparing financial statements based on recording revenues when cash is received and reporting expenses when the cash is paid is called:multiple choiceaccrual basis accounting.operating cycle accounting.cash basis accounting.revenue recognition accounting.current basis accounting.

Answers

The system of preparing financial statements based on recording revenues when cash is received and reporting expenses when the cash is paid is called Cash Basis Accounting.

Cash basis accounting is an accounting method that reports income when it is received and expenses when they are paid. Cash basis accounting is a straightforward method of keeping track of the company's financial activities.

The advantages of Cash Basis Accounting are:

Easy to understand, Quick to establish, Less expensive than the accrual basis accounting method, and it's ideal for small businesses with no inventory or accounts receivable.

The disadvantage of Cash Basis Accounting is that it can distort a company's financial position because it does not accurately reflect long-term trends and does not comply with the Generally Accepted Accounting Principles (GAAP).

For more questions on: financial statements

https://brainly.com/question/14615122

#SPJ8

A company reported net income of $201,400 during 2022. The company reported depreciation expense of $42,000, patent amortization of $13,500 and a $6,400 loss on the sale of equipment. Using the indirect method, how much is the company's net cash flow from operating activities?

Answers

The company's net cash flow from operating activities using the indirect method is $244,100.

To calculate the net cash flow from operating activities using the indirect method, we start with the company's net income and adjust for non-cash expenses and gains/losses. In this case, we have the following adjustments:

1. Depreciation Expense: Since depreciation is a non-cash expense, we add it back to net income. The depreciation expense of $42,000 is added back.

2. Patent Amortization: Similar to depreciation, patent amortization is a non-cash expense. We add the patent amortization of $13,500 back to net income.

3. Loss on Sale of Equipment: Losses on the sale of equipment are subtracted as they are not included in net income. Here, the loss on the sale of equipment is $6,400, which is subtracted.

To calculate the net cash flow from operating activities, we take the net income and adjust it for the above items:

Net Income + Depreciation Expense + Patent Amortization - Loss on Sale of Equipment

= $201,400 + $42,000 + $13,500 - $6,400

= $250,500 - $6,400

= $244,100

Therefore, the company's net cash flow from operating activities, using the indirect method, is $244,100.

Learn more about company here: brainly.com/question/30532251

#SPJ11

A payment on account to a vendor is recorded in the
Multiple Choice
Purchases journal.
Sales journal.
Cash receipts journal.
Cash payments journal.

Answers

The payment on account to a vendor is recorded in the Cash payments journal.

The Cash payments journal is used to record all cash payments made by a company, including payments to vendors for accounts payable. When a payment is made to a vendor on account, it represents a reduction in the company's accounts payable balance. The Cash payments journal allows for the systematic recording of these transactions, providing a clear record of all cash outflows.

In the Cash payments journal, the payment to the vendor would be recorded by debiting the accounts payable account to reduce the amount owed to the vendor and crediting the cash account to reflect the decrease in cash due to the payment. This journal entry helps maintain accurate records of the company's financial transactions and allows for easy tracking of cash payments to vendors.

It's important to note that the Purchases journal is used to record purchases of inventory on credit, not payments to vendors. The Sales journal is used to record sales of goods or services. The Cash receipts journal is used to record cash received from customers, not payments to vendors. Therefore, the appropriate journal for recording a payment on account to a vendor is the Cash payments journal.

Learn more purchases journal here:

brainly.com/question/32420859

#SPJ11

. Which of the following statements is (are) correct?
(x) If the quantity supplied increases by a smaller percentage than the percentage increase in the price of the good, then the coefficient of price elasticity of supply is a number smaller than one.
y) If the quantity supplied changes only slightly when the price of the good changes a large amount, then the coefficient of price elasticity of supply is a number smaller than one.
(z) If the coefficient of price elasticity of supply has a value of 1, then the percentage change in price equals the percentage change in quantity supplied.
a. (x), (y) and (z)
b. (x) and (y) only
c. (x) and (z) only
d. (y) and (z) only
e. (x) only
3.Which of the following statements is valid when the market supply curve is vertical?
(x) An increase in market demand will increase the equilibrium price.
(y) An increase in market demand will increase the equilibrium quantity.
(z) Market quantity supplied does not change when the price changes because supply is perfectly inelastic
a. (x), (y) and (z)
b. (x) and (y) only
c. (x) and (z) only
d. (y) and (z) only
e. (x) only

Answers

Correct Statements for the first question is (e) (x) only, and for the second question is (c) (x) and (z) only.

Understanding the concepts of price elasticity of supply and the characteristics of market supply curves is important in economics. In this explanation, we will delve into the given questions and explore the correct answers in detail, providing mathematical explanations where applicable.

Question 1:

Let's evaluate each statement one by one to determine which option is correct.

(x) If the quantity supplied increases by a smaller percentage than the percentage increase in the price of the good, then the coefficient of price elasticity of supply is a number smaller than one.

This statement is correct. Price elasticity of supply measures the responsiveness of quantity supplied to changes in price. If the quantity supplied increases by a smaller percentage than the percentage increase in price, it implies that suppliers are not very responsive to price changes. In this case, the coefficient of price elasticity of supply will be less than one, indicating relatively inelastic supply.

(y) If the quantity supplied changes only slightly when the price of the good changes a large amount, then the coefficient of price elasticity of supply is a number smaller than one.

This statement is also correct. When the quantity supplied changes only slightly in response to a large change in price, it indicates that supply is relatively unresponsive to price changes. Consequently, the coefficient of price elasticity of supply will be less than one.

(z) If the coefficient of price elasticity of supply has a value of 1, then the percentage change in price equals the percentage change in quantity supplied.

This statement is incorrect. A price elasticity of supply equal to 1 indicates unitary elasticity, where the percentage change in quantity supplied is equal to the percentage change in price. However, it does not imply that the values of these changes are equal. They can still differ; the important point is their proportional relationship.

Based on the evaluation above, the correct answer is (e) (x) only. Statement (y) is also correct, but statement (z) is incorrect.

Question 2:

Now, let's analyze the given statements about a vertical market supply curve and determine the correct option.

(x) An increase in market demand will increase the equilibrium price.

This statement is correct. When the market demand increases, there is a higher willingness to pay for the good, which puts upward pressure on the equilibrium price.

(y) An increase in market demand will increase the equilibrium quantity.

This statement is incorrect. A vertical supply curve implies that the quantity supplied remains constant regardless of price changes. Therefore, an increase in market demand will not affect the equilibrium quantity.

(z) Market quantity supplied does not change when the price changes because supply is perfectly inelastic.

This statement is correct. A vertical supply curve represents perfectly inelastic supply, meaning the quantity supplied does not change regardless of price fluctuations. Thus, statement (z) is valid.

Based on the evaluation above, the correct answer is (c) (x) and (z) only. Statement (y) is incorrect because an increase in market demand does not affect the equilibrium quantity when the supply curve is vertical.

In summary, for the first question, the correct answer is (e) (x) only, and for the second question, the correct answer is (c) (x) and (z) only.

To know more about Price Elasticity here

https://brainly.com/question/30161342

#SPJ4

You want to go to Europe 5 years from now, and you can save $2,000 per year, beginning one year from today. You plan to deposit the funds in a mutual fund that you think will return 7% per year. Under these conditions, how much would you have just after you make the 5th deposit, 5 years from now?
a. $13,369
b. $11,274
c. $11,501
d. $11,964
e. $12,327

Answers

The correct option is d. The amount you would have after you make the 5th deposit, 5 years from now given the given conditions is $11,964. To calculate this, you have to use the Future Value (FV) formula given as;FV = PV x (1 + r). Putting the values in the formula, FV = $2,000 x (1 + 0.07)⁴FV = $2,000 x 1.3108FV = $2,621.60.

The value of the 1st deposit after 4 years will be $2,000 x 1.3108 = $2,621.60Similarly, the value of the 2nd deposit after 3 years will be $2,000 x 1.2250 = $2,450The value of the 3rd deposit after 2 years will be $2,000 x 1.1449 = $2,289.80The value of the 4th deposit after 1 year will be $2,000 x 1.0765 = $2,153.

The value of the 5th deposit immediately after it is made, after 5 years will be $2,000 x 1 = $2,000. FV = $2,621.60 + $2,450 + $2,289.80 + $2,153 + $2,000FV = $11,964Therefore, the amount you would have after you make the 5th deposit, 5 years from now given the given conditions is $11,964, which is option d.

To know more about Future Value visit:-

https://brainly.com/question/30787954

#SPJ11

When 3 people work together on a gang job, producing 1,877 units per hour for an eight-hour shift, and earn $15.03 per hour each, what is the direct labor cost for each unit to the nearest $0.001? Do not include the $ sign in your

Answers

When three people work together on a gang job, producing 1,877 units per hour for an eight-hour shift and earning $15.03 per hour each, the task is to calculate the direct labor cost for each unit to the nearest $0.001.

To calculate the direct labor cost per unit, we need to determine the total labor cost for the eight-hour shift and divide it by the total number of units produced. The total labor cost for the three workers for an eight-hour shift can be calculated as follows:

Total Labor Cost = Number of Workers × Hours Worked × Hourly Wage

                = 3 workers × 8 hours × $15.03 per hour

Next, we need to calculate the total number of units produced during the eight-hour shift:

Total Units Produced = Units per Hour × Hours Worked

                    = 1,877 units per hour × 8 hours

Finally, we can determine the direct labor cost per unit by dividing the total labor cost by the total number of units produced:

Direct Labor Cost per Unit = Total Labor Cost / Total Units Produced

By performing these calculations, we can find the direct labor cost per unit to the nearest $0.001.

Learn more about Hourly Wage here:- brainly.com/question/20560516

#SPJ11

: Required information [The following information applies to the questions displayed below.] Kubin Company's relevant range of production is 29,000 to 33,000 units. When it produces and sells 31,000 units, its average costs per unit are as follows: Direct materials Direct labor Variable manufacturing overhead Fixed manufacturing overhead Fixed selling expense Fixed administrative expense Sales commissions Variable administrative expense Average Cost per Unit $8.90 $5.90 $ 3.40 $ 6.90 $ 5.40 $ 4.40 $ 2.90 $ 2.40 1. Assume the cost object is units of production: a. What is the total direct manufacturing cost incurred to make 31,000 units? (Round per unit values to 2 decimal places.) b. What is the total indirect manufacturing cost incurred to make 31,000 units? (Round per unit values to 2 decimal places.) 1a. Direct materials per unit 1a. Direct labor per unit 1a. Direct manufacturing cost per unit 1a. Number of units produced and sold 1a. Total direct manufacturing cost 1b. Variable manufacturing overhead per unit 1b. Fixed manufacturing overhead per unit 1b. Indirect manufacturing cost per unit 1b. Number of units produced and sold 1b. Total indirect manufacturing cost $ $ $ $ 0.00 0 0.00 0 2. Assume the cost object is the Manufacturing Department and that its total output is 31,000 units. a. How much total manufacturing cost is directly traceable to the Manufacturing Department? (Round per unit values to 2 decimal places.) b. How much total manufacturing cost is an indirect cost that cannot be easily traced to the Manufacturing Department? Show less A 2a. Direct materials per unit 2a. Direct labor per unit 2a. Variable manufacturing overhead per unit 2a. Fixed manufacturing overhead per unit 2a. Total manufacturing cost per unit 2a. Number of units produced and sold 2a. Total direct costs 2b. Total indirect costs $ $ 0.00 0 3. Assume the cost object is the company's various sales representatives. Furthermore, assume that the company spent $136,400 of its total fixed selling expense on advertising and the remainder of the total fixed selling expense comprised the fixed portion of the company's sales representatives' compensation. a. When the company sells 31,000 units, what is the total direct selling expense that can be readily traced to individual sales representatives? (Round per unit value to 2 decimal places.) b. When the company sells 31,000 units, what is the total indirect selling expense that cannot be readily traced to individual sales representatives? 3a. Sales commissions per unit 3a. Number of units sold 3a. Total sales commission 3a. Fixed portion of sales representatives' compensation 3a. Total direct selling expense 3b. The total indirect selling expense $ $ 0 Show less

Answers

1a.  total direct manufacturing cost incurred to make 31,000 units is $564,200.

1b, Therefore, the total indirect manufacturing cost incurred to make 31,000 units is $592,100.

2a. total manufacturing cost directly traceable to the Manufacturing Department is $564,200.

2b.there is no specific information provided for indirect manufacturing costs, so the total indirect manufacturing cost is $0.

3a. the total direct selling expense that can be readily traced to individual sales representatives is $89,900.

3b, total indirect selling expense that cannot be readily traced to individual sales representatives is $31,000.

1a. To calculate the total direct manufacturing cost incurred to make 31,000 units, we need to multiply the average cost per unit for direct materials, direct labor, and variable manufacturing overhead by the number of units produced and sold.
Direct materials per unit: $8.90
Direct labor per unit: $5.90
Variable manufacturing overhead per unit: $3.40
Number of units produced and sold: 31,000
Total direct manufacturing cost = (Direct materials per unit + Direct labor per unit + Variable manufacturing overhead per unit) * Number of units produced and sold
= ($8.90 + $5.90 + $3.40) * 31,000
= $18.20 * 31,000
= $564,200
Therefore, the total direct manufacturing cost incurred to make 31,000 units is $564,200.
1b. The total indirect manufacturing cost incurred to make 31,000 units is the sum of the fixed manufacturing overhead, fixed selling expense, fixed administrative expense, and variable administrative expense per unit, multiplied by the number of units produced and sold, since these costs are considered indirect.
Total indirect manufacturing cost = (Fixed manufacturing overhead per unit + Fixed selling expense per unit + Fixed administrative expense per unit + Variable administrative expense per unit) * Number of units produced and sold
= ($6.90 + $5.40 + $4.40 + $2.40) * 31,000
= $19.10 * 31,000
= $592,100, Therefore, the total indirect manufacturing cost incurred to make 31,000 units is $592,100.

2a. Since the cost object is the Manufacturing Department, we consider all the costs directly traceable to the department. Thus, the total manufacturing cost directly traceable to the Manufacturing Department is the sum of the direct materials, direct labor, and variable manufacturing overhead per unit, multiplied by the total output of the Manufacturing Department (31,000 units).
Total direct costs traceable to the Manufacturing Department = (Direct materials per unit + Direct labor per unit + Variable manufacturing overhead per unit) * Number of units produced and sold
= ($8.90 + $5.90 + $3.40) * 31,000
= $18.20 * 31,000
= $564,200
Therefore, the total manufacturing cost directly traceable to the Manufacturing Department is $564,200

2b. . The total indirect manufacturing cost is the remaining manufacturing cost that cannot be easily traced to the Manufacturing Department. In this case, there is no specific information provided for indirect manufacturing costs, so the total indirect manufacturing cost is $0.

3a. To calculate the total direct selling expense that can be readily traced to individual sales representatives, we consider the sales commissions per unit and the number of units sold.

Total direct selling expense traced to individual sales representatives = Sales commissions per unit * Number of units sold

= $2.90 * 31,000

= $89,900

Therefore, the total direct selling expense that can be readily traced to individual sales representatives is $89,900.herefore, the total direct selling expense that can be readily traced to individual sales representatives is $89,900.

3b. The total indirect selling expense that cannot be readily traced to individual sales representatives is the remaining fixed selling expense after deducting the portion spent on advertising.
Total indirect selling expense = Total fixed selling expense - Amount spent on advertising
= Fixed selling expense - Amount spent on advertising
= $5.40 * 31,000 - $136,400
= $167,400 - $136,400
= $31,000
Therefore, the total indirect selling expense that cannot be readily traced to individual sales representatives is $31,000.

For more such question on manufacturing cost

https://brainly.com/question/14699408

#SPJ8

If you have a large amount of text that you want to place in different locations in a document, with the text continuing from one text box to another, you can use _______ text boxes. Select one:

a. Aggregated

b. Embedded

c. Linked

d. Baseline

Answers

The answer is c) Linked Text Boxes.

When dealing with a large amount of text that needs to be placed in different locations in a document, with the text flowing seamlessly from one text box to another, linked text boxes are used. Linked text boxes allow for continuous and uninterrupted flow of text across multiple text boxes.

By linking text boxes, you establish a connection between them, forming a chain or sequence. The text will automatically flow from one text box to the next, following the designated order. This feature is commonly used in documents such as newsletters, brochures, and magazine layouts where text needs to span across multiple pages or columns.

To link text boxes, you typically start by placing the initial text box and entering the desired content. Then, you create additional text boxes and connect them using specific tools or commands provided by the software you are using, such as Adobe InDesign or Microsoft Word.

By utilizing linked text boxes, you can efficiently manage and organize lengthy text while maintaining its readability and structure throughout the document.

To know more about text boxes click here: brainly.com/question/31918055

#SPJ11

Stripe Revolutionizes Digital Payments
Raised in Ireland, Patrick and John Collison were precocious, inquisitive youngsters who taught themselves computer coding at an early age. By the time they were teenagers, the brothers were developing iPhone apps and eventually became college dropouts after a few semesters at MIT (Patrick) and Harvard (John). During this time they started a company called Auctomatic Inc., which created an online marketplace management system for companies such as eBay, and then sold the company for $5 million in 2008.
After selling the business, they continued to work on simplifying the payment process for startup businesses that use the internet to sell goods and services. As the internet entered its second decade and more and more entrepreneurs were using the web to do business, the Collisions recognized that the payment transaction process for online purchases needed an overhaul. In 2011, they opened their new company, Stripe, after testing their service and building relationships with banks, credit card companies, and regulators, so clients could focus their energies on building their businesses—and not building a payment infrastructure from scratch.
Using Stripe, businesses only need to add seven lines of coding to their websites to handle payments—a process that previously could have taken weeks to perfect. Word spread quickly among developers that the Collison brothers’ simple coding architecture could indeed disrupt the payment processing industry. As more and more marketplace companies and other online services needed to divvy up payments between vendors and consumers, Stripe became the go-to company to figure out how to move money online quickly and to get people (and companies) paid. The company’s engineers determined how to separate payments for some of the internet’s startups such as Lyft, which needed consumers to pay for rides and drivers to be compensated quickly. Stripe engineers worked their magic to bypass typical banking protocol and linked payments to Lyft drivers via their debit cards, which allowed them to be paid promptly.
After seven years in business, Stripe is now the financial "back office" for more than 100,000 businesses that take mobile payments—some of the startups and some of the big businesses such as Amazon, Salesforce, and Target. The company charges a 2.9 percent fee on credit card payments in exchange for its services. Although Stripe’s sales data is confidential, analysts estimate Stripe handles more than $50 billion in commerce annually, which translates to nearly $1.5 billion in revenue.
With more than 750 employees, Stripe continues to expand its product offerings in an effort to give customers and potential clients new tools they can use to help grow their business. For example, Radar, Stripe’s fraud detection service, uses artificial intelligence to analyze payments on its extensive network to identify suspicious activity. By looking at such a large data set on its own network, Stripe can spot patterns better than a single company reviewing its own transactions. The company recently rolled out another tool called Atlas, which can help a local or overseas startup incorporate, get a taxpayer ID number and U.S. bank account, and receive legal and tax advice on forming a company—for a fee of $500 and a few simple clicks. Typically this process would take months, many visits to the United States (if a foreign business), and large legal fees.
Stripe continues to disrupt the payment processing industry, and its Irish co-founders believe they have what it takes to continue building a simple internet infrastructure that will allow startups across the globe to do business and handle mobile payments efficiently—giving entrepreneurs more time to focus on growing successful businesses.
Critical Thinking Questions
Do you think Stripe’s strategy of keeping things simple is a sound business plan? Explain your reasoning.
What impact do you think the company’s Atlas product offering will have on Stripe’s global expansion?
Do you think Stripe’s agility in working with so many different businesses provides the company with a competitive advantage over big banks and credit card companies? Justify your answer.

Answers

Stripe Revolutionizes Digital Payments

Stripe, a leading technology company, has revolutionized digital payments with its innovative platform.

Stripe has made a significant impact in the world of digital payments by introducing a revolutionary platform that has transformed the way businesses and individuals conduct online transactions. The company's innovative approach and comprehensive suite of services have made it a popular choice among businesses of all sizes, from startups to multinational corporations.

One of the key reasons for Stripe's success is its commitment to simplifying the payment process. The platform provides a seamless integration that enables businesses to easily accept payments from customers across multiple channels, including websites, mobile apps, and marketplaces. With its robust infrastructure and powerful APIs, Stripe has made it easier than ever for businesses to manage transactions securely and efficiently.

Another notable feature of Stripe is its global reach. The platform supports payments in over 135 currencies, allowing businesses to expand their operations internationally without the complexities and barriers associated with cross-border payments. This has opened up new opportunities for businesses to tap into global markets and reach customers worldwide.

Furthermore, Stripe's focus on developer-friendly tools and resources has been instrumental in driving its success. The company offers a comprehensive set of APIs and documentation that empowers developers to build custom payment solutions tailored to their specific needs. This flexibility and customization have made Stripe a preferred choice among developers and technology enthusiasts.

In summary, Stripe has revolutionized digital payments by providing a user-friendly, globally accessible platform that simplifies the payment process and offers advanced features for businesses. Its commitment to innovation, global reach, and developer-friendly approach has positioned Stripe as a game-changer in the digital payments landscape.

Learn more about Digital Payments

brainly.com/question/30739089

#SPJ11

Renowned luxury jewellery brand Tiffany & Co. last month rolled out a campaign with the phrase ‘Not Your Mother’s Tiffany’ as its slogan. The campaign is said to be a strategic move by the brand to entice younger customers. However, the campaign sparks backlash as some people see this campaign as overlooking longtime loyal fans, especially due to Tiffany & Co.’s status as a trans-generational brand as their products are often passed on from mother to daughter, highlighting its classic and timeless style. Entrepreneur Rachel ten Brink even tweeted that the campaign ‘disses’ Tiffany's existing customers, while another user sees it as an offense towards middle-aged women.With videos circulating across social media and posters plastered all around New York and Los Angeles that feature young, edgy-looking models, the campaign also marks an early sign of the brand's new chapter as well as its new direction under LVMH. As reported by BoF, by 2025, Millennials and Gen Z will account for 45% of global luxury sales. That is why over these past few years, the public has noticed that Tiffany & Co. has been attempting to resonate more with this particular target group. The brand’s collaboration with Elle Fanning and A$AP Ferg as well as its recent campaign that features Chinese superstar Jackson Yee can be seen as examples of this strategy.
As reported by Marketing Brew, some luxury brand marketers consider this as a wrong move. They expect that a brand as iconic as Tiffany & Co. would use a more unique approach to appeal to younger customers. Plus, the ‘not your mother’s’ slogan is deemed as a total cop out. However, some also think that this positioning is effective, as we are in a time when relevance is everything, and brands might need to lure the next generation of loyalists.
Evaluate Tiffany & Co positioning strategy considering changes in the management over time. Discuss advantages and risks of this strategy for the brand.

Answers

Tiffany & Co. has implemented a new positioning strategy to attract younger customers, marked by the campaign slogan 'Not Your Mother's Tiffany.' This move reflects the brand's attempt to resonate with Millennials and Gen Z, who are expected to make up a significant portion of global luxury sales.

While some critics argue that the campaign overlooks loyal customers and lacks uniqueness, others believe it is an effective strategy in a time where brands must stay relevant and appeal to the next generation.

Tiffany & Co.'s positioning strategy has evolved over time, particularly under the management of LVMH. Recognizing the changing consumer landscape and the growing importance of Millennials and Gen Z, the brand has sought to establish a connection with these younger demographics. Collaborations with influencers like Elle Fanning, A$AP Ferg, and Jackson Yee are part of this strategy to create a relatable and contemporary image.

The advantages of this positioning strategy are clear. By targeting younger consumers, Tiffany & Co. can tap into a demographic that will drive future luxury sales. It allows the brand to stay relevant and adapt to evolving consumer preferences, ensuring long-term sustainability. Connecting with Millennials and Gen Z through influencers and contemporary campaigns can help create a fresh perception of the brand and attract new customers.

However, there are risks involved in this strategy. The 'Not Your Mother's Tiffany' campaign has faced backlash, with loyal customers feeling overlooked and even offended. The risk lies in alienating the existing customer base, who may associate Tiffany & Co. with classic and timeless styles passed down through generations. The campaign's focus on young, edgy models may also create a perception that the brand is abandoning its traditional heritage.

Additionally, some critics argue that the positioning strategy lacks uniqueness and fails to fully leverage Tiffany & Co.'s iconic status. They suggest that the brand should explore more innovative and distinctive approaches to capture the attention of younger customers, rather than relying on a generic slogan.

In conclusion, Tiffany & Co.'s positioning strategy targeting younger customers through the 'Not Your Mother's Tiffany' campaign has both advantages and risks. While it aims to secure the brand's future by appealing to Millennials and Gen Z, it must navigate the challenge of maintaining loyalty among existing customers and find ways to differentiate itself in a highly competitive luxury market. Striking a balance between modernization and honouring the brand's heritage will be crucial for long-term success.

Learn more about positioning strategy here:

brainly.com/question/31575056

#SPJ11

aximum New Sites This is the maximum growth rate as measured by the number of new customer sites. Current Value: 350 new customer sites. The current value is based simply on experience estimates that indicate this is the maximum number of growth opportunities available this year. Constraints: Value range is between 0 and 1,000 Specification of large targets runs the risk of adding demand that can't be met by the current scale of operations. Specification of very low targets runs the risk of failing to meet business requirements for growth in revenues. Assumptions: (specify here an assumption associated with this target

Answers


The maximum growth rate for the number of new customer sites is currently set at 350. This value is based on experience estimates, indicating that it represents the maximum number of growth opportunities available this year.


Constraints for this target include a value range between 0 and 1,000. This means that the growth rate cannot exceed 1,000 or be below 0.

It is important to consider the specification of large targets, as it runs the risk of adding demand that cannot be met by the current scale of operations. This means that setting a very high target may put a strain on the operations and may not be feasible.

On the other hand, specifying very low targets runs the risk of failing to meet business requirements for growth in revenues. This means that setting a target that is too low may not meet the company's needs for revenue growth.

One assumption associated with this target is not provided in the question.

To learn more about "Demand" visit: https://brainly.com/question/30703626

#SPJ11

The time studies should be done in centi-minutes (60 secs = 100 centi-minutes) - to whole centi-minutes. • Use an appropriate time study form to record your readings (an example is on page 272 in the prescribed text book). • Follow the appropriate steps in doing the time study. • Do the time study using approach 1 (refined approach) below. There are alternative approaches to this one. 1. Determine the work content (standard time) for the union assembly by dividing it into 3 elements as follows: A. Pick up of nut and pipe parts from bins, dipping of both parts in lubricants, etc. Break point: Start of reaching for both nut and pipe. B. Threading together of the nut and pipe parts till tightened. Break point: Start of threading motion. C. Inspect both ends of union, and drop off. Break point: Start of inspection Use an average standard performance for the 3 complete cycles and a 10 percent allowance across all elements. The average rating for each of the 3 elements over the 3 complete cycles is assumed at standard performance. Use the formula on page 292 in the prescribed text book to determine the appropriate sample sizes for elements A, B, and C. • Use the given template to complete the time studies. [Total marks: 50]

Answers

time studies in centi-minutes. Time studies should be done to whole centi-minutes and an appropriate time study form should be used to record readings. The time study should be done using the refined approach which involves determining the work content for the union assembly by dividing it into three elements.

These elements are:Pick up of nut and pipe parts from bins, dipping of both parts in lubricants, etc. Break point: Start of reaching for both nut and pipe.Threading together of the nut and pipe parts till tightened. Break point: Start of threading motion.Inspect both ends of union, and drop off. Break point: Start of inspection.

An average standard performance should be used for the three complete cycles and a 10 percent allowance should be given across all elements. The average rating for each of the three elements over the three complete cycles is assumed at standard performance.To determine the appropriate sample sizes for elements A, B, and C, the formula on page 292 in the prescribed text book should be used.The given template should be used to complete the time studies.

TO know more about that appropriate visit:

https://brainly.com/question/9262338

#SPJ11

Assume tuition and fees at Wichita State University cost $4,259 in
2004. If the price index was 184 in 2004 and 245 in 2018, then the
adjusted price for tuition would be. (Round to the nearest
dollar)

Answers

To calculate the adjusted price for tuition using the price index, first find the ratio of the price index in the year you want to adjust to the price index in the base year. Then, multiply this ratio by the cost in the base year to find the adjusted price. Finally, round to the nearest dollar.

In order to find the adjusted price for tuition in 2018 using the price index, follow these steps:

Calculate the ratio of the price index in 2018 to the price index in 2004:245/184 = 1.3315 Multiply this ratio by the 2004 tuition and fees cost:1.3315 x $4,259 = $5,668.61

Round this amount to the nearest dollar: $5,669Therefore, the adjusted price for tuition in 2018 would be $5,669.

For more such questions on price index, click on:

https://brainly.com/question/24275900

#SPJ8

golden corporation is a c corporation. the company had ordinary income of $2,000 and incurred a $4,000 net capital loss in 20x8. what the amount of capital loss golden is allowed to deduct in 20x8?

Answers

In 20x8, as a C corporation, Golden Corporation is allowed to deduct up to $3,000 of its net capital loss. This deduction is known as the capital loss deduction. The remaining capital loss of $1,000 can be carried forward to future years to offset any future capital gains.

The capital loss deduction is limited to $3,000 per year for C corporations. This means that even though Golden Corporation incurred a net capital loss of $4,000, it can only deduct $3,000 in 20x8. The remaining $1,000 can be carried forward indefinitely until it is fully utilized.
It's important to note that the capital loss deduction can only be used to offset capital gains. If Golden Corporation does not have any capital gains in 20x8, it cannot utilize the capital loss deduction in that year. However, the carried forward capital loss can be used to offset any future capital gains in subsequent years.
Overall, in 20x8, Golden Corporation is allowed to deduct $3,000 of its net capital loss, with the remaining $1,000 carried forward for future use. This deduction helps to reduce its taxable income and can be a valuable tax planning tool for corporations.

To know more capital loss deduction visit:

https://brainly.com/question/32338813

#SPJ11

Current Attempt in Progress Matrix Consulting Agency signed a 10-year, 4.50%, $400,000 mortgage on June 30, 2021, to help finance a new office building. The mortgage terms provide for semi-annual payments of $25,057. Payments are due on December 31 and June 30. The company's year end is June 30. (a) Prepare an instalment payment schedule for the first two years. (Round answers to the nearest whole dollar, e.g. 5,275.) Semi- annual Cash Payment Interest Expense Reduction of Principal Interest Period June 30, 2021 Dec. 31, 2021 June 30, 2022 Dec. 31, 2022 June 30, 2023 4 $ 25057 25057 25057 25057 $ JOU $ Prin Bal Record the receipt of the mortgage loan on June 30, 2021. (Credit account titles are automatically indented when the amount is entered. Do not indent manually. List all debit entries before credit entries.) Date Account Titles and Explanation Debit Credit June 30

Answers

Answer:

Instalment payment schedule for the first two years:

Semi-Annual Cash Payment Interest Expense Reduction of Principal Interest Period June 30, 2021 $ 25,057 $ 3,600 $ 21,457 Dec. 31, 2021 $ 25,057 $ 18,127 $ 7,930 $ 16,327 June 30, 2022 $ 25,057 $ 16,327 $ 9,731 $ 14,596 Dec. 31, 2022 $ 25,057 $ 14,596 $ 11,461 $ 12,135 June 30, 2023 $ 25,057 $ 12,135 $ 13,922 $ 9,213

Record the receipt of the mortgage loan on June 30, 2021:

Date Account Titles and Explanation Debit Credit June 30, 2021 Cash $ 400,000 Mortgage Payable $ 400,000

Explanation:

Identify social/society/customer problem that are not solved well or not solved at all and can be converted into a business opportunity
(ethical and legal)
mention at least 3

Answers

Identifying social/society/customer problems that are not solved well or not solved at all and can be converted into a business opportunity involves the ability to think outside the box and come up with innovative solutions that can benefit people while being ethical and legal.

Below are three examples of such problems that can be converted into a business opportunity:

1. Waste Management and Recycling: The improper disposal of waste and the lack of proper recycling facilities are major problems that affect many communities worldwide. Many governments and organizations have attempted to solve these problems, but they are still not well-solved. One can turn these problems into a business opportunity by creating an environmentally-friendly company that deals with waste management and recycling. Such a company would be beneficial to society by providing a clean and safe environment.

2. Transportation: Transportation is another problem that affects many people globally. Many cities and towns have inadequate public transportation, which often leads to congestion and environmental pollution. Creating a company that provides safe, efficient, and affordable transportation could help alleviate this problem. Such a company would be beneficial to society by reducing traffic congestion, and pollution, and providing affordable transportation to people.

3. Healthcare: Healthcare is another area that is not well-solved. Many people do not have access to quality healthcare, and even those who do are often faced with high costs and long wait times. Creating a company that provides quality and affordable healthcare services could help alleviate this problem. Such a company would be beneficial to society by providing access to quality healthcare and reducing the burden on the public health system.

In conclusion, identifying social/society/customer problems that are not solved well or not solved at all and can be converted into a business opportunity requires a critical thinking approach. By finding innovative and ethical solutions to these problems, entrepreneurs can create businesses that benefit society while providing valuable service to customers.

Know more about Business opportunity here:

https://brainly.com/question/26205749

#SPJ8

A 9-year annuity of 18 $8,800 semiannual payments will begin 10.5 years from now, with the first payment coming 11 years from now.
a. If the discount rate is 12 percent compounded semiannually, what is the value of this annuity nine years and seven years from now? Do not round intermediate calculations and round your answers to 2 decimal places, e.g., 32.16. b. What is the value of the annuity today? Do not round intermediate calculations and round your answer to 2 decimal places, e.g., 32.16. a. Value nine years from today Value seven years from today b. Value today

Answers

a. The future value of annuity can be calculated using the following formula;FV= (A/2)[(1+r/m)^n - 1](2/m)Where;A is the semi-annual payment, r is the interest rate, n is the number of payments and m is the number of compounding periods per year.

Using the above formula;At nine years from todayThe semiannual payment is $8,800The discount rate is 12% compounded semiannuallyTherefore the interest rate is 6% (12%/2)The number of payments is 9 * 2 = 18The future value of the annuity at the end of nine years is;FV = (8,800/2)[(1+0.06)^18 - 1](2/2) = $232,548.02At seven years from todayThe semiannual payment is $8,800The discount rate is 12% compounded semiannuallyTherefore the interest rate is 6% (12%/2)The number of payments is 7 * 2 = 14The future value of the annuity at the end of seven years is;FV = (8,800/2)[(1+0.06)^14 - 1](2/2) = $184,760.21b.

The present value of annuity can be calculated using the following formula;PV= (A/2)[1 - (1+r/m)^-n](2/m)rWhere;A is the semi-annual payment, r is the interest rate, n is the number of payments and m is the number of compounding periods per year.Using the above formula;The semiannual payment is $8,800The discount rate is 12% compounded semiannuallyTherefore the interest rate is 6% (12%/2)The number of payments is 9 * 2 = 18The present value of the annuity today is;PV= (8,800/2)[1 - (1+0.06)^-18](2/0.06) = $95,141.39Therefore,

To know more about Payment visit:-

https://brainly.com/question/32714395

#SPJ11

in the following games, you lay down $1 to bet that you will pick a certain card in a fair draw from a standard deck. if you lose, then you lose your $1. if you win, then you collect the gross amount indicated, so your net gain is $1 less.what is the expected financial value of a bet where you will win $10 if you draw a queen?

Answers

The expected financial value of a bet where you will win $10 if you draw a queen is -$0.15.

In the given game, you bet $1 to draw a certain card from a standard deck. If you lose, you lose your $1, but if you win, you collect the gross amount indicated. You will win $10 if you draw a queen.

To calculate the expected financial value of this bet, you need to consider the probability of drawing a queen. In a standard deck, there are 4 queens out of 52 cards.

So, the probability of drawing a queen is 4/52 or 1/13.

To calculate the expected financial value, you multiply the probability of winning ($10) by the probability of drawing a queen (1/13) and subtract the probability of losing ($1) multiplied by the probability of not drawing a queen (12/13).

In this case, the expected financial value is [(10 * 1/13) - (1 * 12/13)] = (10/13 - 12/13) = -2/13 or approximately -$0.15.

Therefore, the expected financial value of this bet is -$0.15.

To know more about financial value visit:

https://brainly.com/question/29510938

#SPJ11

As the field of OSCM has advanced, new concepts have been applied to help businesses compete in a number of ways, including sustainability, a form of social responsibility. Discuss how the idea of sustainability is used by companies toady in their Operations Strategies. Provide a specific example of one of these improvements within OSCM.

Answers

Sustainability is a crucial component of Operations Strategies in today's business environment. Companies utilize various measures, such as product design, sourcing practices, manufacturing processes, and reverse logistics, to integrate sustainability into their OSCM practices.

As the field of Operations and Supply Chain Management (OSCM) has advanced, new concepts have been applied to help businesses compete in a number of ways. One of these concepts is sustainability, which is a form of social responsibility. Companies today use the idea of sustainability in their Operations Strategies to minimize their environmental impact, conserve resources, and meet the needs of present and future generations.

Sustainability is integrated into various aspects of Operations Strategies, including product design, sourcing, manufacturing processes, distribution, and end-of-life management. For example, companies may design products that are more energy-efficient, use eco-friendly materials, or have a longer lifespan. They may also source raw materials from sustainable sources, implement green manufacturing practices, optimize transportation routes to reduce emissions, and adopt recycling and waste reduction programs.

A specific example of an improvement within OSCM related to sustainability is the implementation of reverse logistics. Reverse logistics involves managing the return, refurbishment, and recycling of products and materials. By incorporating reverse logistics into their Operations Strategies, companies can reduce waste, recover value from returned products, and contribute to a circular economy.

To learn more about "Operations Strategies" visit: https://brainly.com/question/19866548

#SPJ11

Other Questions
Question 17 Homework Unanswered The current equilibrium price of oil is $100 per barrel and the equilibrium quantity of oil is 96 million barrels per day. OPEC increases its oil production by 4 million barrels per day. The price elasticity of demand for oil is -0.2, while the supply of oil is perfectly inelastic over the period of time in question. Based on this information, you predict that after the OPEC's production increase, the equilibrium price of oil will be $ per barrel. Type your numeric answer and submit Fill in the Blanks Type your answers in all of the blanks and submit X, Suppose Amazon raises its Prime membership fee from $119 to $139. The price elasticity of demand for Amazon Prime subscriptions in this price range is -1.2. You predict that the quantity of subscriptions demanded will (increase/decrease) Write your response here.... by Type your answer here. % and that Amazon's total revenue will (increase/decrease) Write your response here.... by Type your answer here. What is the sentence pattern of the given sentence?Neil painted his house.Subject - Verb of being - AdjectiveO Subject - Verb transitive - Indirect object - Direct objectO Subject - Transitive verb - Direct ObjectO Subject - Transitive Verb - Adverb A marginal abatement cost that shows a factory'spollution is represented by MAC= 360 - 5E with a tax per unit equalto 20$. How much will the factory reduce its emissions? SHOW FULLCALCULATIONS The property and equipment section of the lululemon athletica 2018 balance sheet follows. Property and Equipment (in thousands) Feb. 3, 2019 Jan. 28, 2018 Land $78,636 $83,048 Buildings 38,030 39,278 Leasehold improvements 362,571 301,449 Furniture and fixtures 103,733 91,778 Computer hardware 69,542 61,734 Computer software 230,689 173,997 Equipment and vehicles 15,009 14,806 Work in progress 74,271 51,260 Property and equipment, gross 972,481 817,350 Accumulated depreciation (384,982) (326,523) Property and equipment, net $587,499 $490,827 Depreciation expense related to property and equipment was $116.3 million and $102.6 million, for the years ended February 3, 2019, and January 28, 2018, respectively.c. Compute the estimated percent used up of lululemons depreciable assets. Note: Round percentage to one decimal place (for example, enter 6.7% for 6.6555%). Answer % 2. List out the primary key(s), foreign key(s) and candidate key(s) for the CustomerOrder table. For this question, you only need to consider the relationship(s) between the CustomerOrder table and the tables within the Order Schema. Do not refer to, or in any way utilize, tables outside of the Order Schema. 22 If we group the first two farms and the last two terms as follows (xy+5y) + (2x + 10) Group 1 what do you notice about each group? Group 2 the Suplay y 12, +alls (1) 23 Factor these values out of each group and then write down the equivalent algebraic expression. 24 What is the common factor in the two terms? 25 Use the distributive property to factor out this common factor and then express the polynomial as a product of two binomials What is the greenhouse effect needed to reach an actual averagetemperature T = 288 K on earth? Classify the following as Homogeneous mixture, Heterogeneousmixture or Pure substance.HCl (aq) Is triangle fgh similar to triangle jkl? If so, identify the similarity postulate or theorem that applies. (Please help!!!) Solve the initial value problem below using the method of Laplace transforms. w +4w=8t^2 +4,w(0)=2, w (0)=20 Click here to view the table of Laplace transforms. Click here to view the table of properties of Laplace transforms. w(t)= 5. Based on your knowledge on basins and domes, what would be the structure associated with the rocks in the northwestern part of the state? (Hint: examine the geologic map and cross-section of Michigan) An atom of 235U absorbs a neutron and undergoes fission, producing 132Sn and 12Mo as fission fragments. 50 42 (a) What is the decay chain initiated by each of the fission fragments? (b) Write the overall fission reaction, taken to the stable end products. (Use x for the number of gamma rays emitted.) (c) How much energy is eventually released? CAN YOU PLEASE ANSWER THIS BIOINFORMATIC QUESTION ASAP!John Louis has been suffering from pancreatic cancer. His DNA has been isolated and ATR gene was sequenced with his request. Sequence of the patients ATR gene is provided below and the reference sequence`s accession number is NM_001184.4 .Patient`s sequence>patient ATRctgatcttgc tgccaaagca agccctgcag cttctgctct cattcgaact ttaggaaaac aattaaatgt caatcgtaga gagattttaa taaacaactt caaatatatt ttttctcatt tggtctgttc ttgttccaaa gatgaattag aacgtgccct tcattatctg aagaatgaaa cagaaattga actggggagc ctgttgagac aagatttcca aggattgcat aatgaattat tgctgcgtat tggagaacac tatcaacagg tttttaatgg tttgtcaata cttgcctcat ttgcatccag tgatgatcca tatcagggcc cgagagatat cgtatcacct gaactgatgg ctgattattt acaacccaaa ttgttgggca ttttggcttt ttttaacatg cagttactgagctctagtgt tggcattgaa gataagaaaa tggccttgaa cagtttgatg tctttgatga agttaatggg acccaaacat gtcagttctg tgagggtgaa gatgatgacc acactgagaa ctggccttcg attcaaggat gattttcctg aattgtgttg cagagcttgg gactgctttg ttcgctgcct ggatcatgct tgtctgggct cccttctcag tcatgtaata gtagctttgt tacctcttat acacatccag cctaaagaaa ctgcagctat cttccactac ctcataattga. Are there any changes in nucleic acid and amino acid sequences? If yes please explain the location(s) and change(s). (3 points)b. Does this change affect the protein domains? Explain in detail. (3 points)c. Based on your analysis in section (a) and (b), does this variation affect the protein function or not? Explain your answer. (2 points)d. Which program(s)/database(s) have you used to answer this question, list respectively. (1 point) Melody, single, taxable income of $52,800, This includes $200 inqualified dividends. What tax rate applies tyo these dividends.A, 0%B, 15%C . 20%D. 25% a star graph algorithm on qt for the enemy to follow the player in the shortest path 5. An nn matrix N is said to be nilpotent if N k=0 for some kN. (a) (6 points) Prove that IN is invertible by finding (IN) 1. (Hint: Think of an analogue to the series 1x1=1+x+x 2+ from calculus Question 8 0.25 pts What is NOT a reason why Labor failed to achieve its goals? Unions were seen as very radical by the establishment Immigrants failed to join the unions Anarchist positively impa Choose the word that best replaces the underlined word.Gustave was wholly dedicated to the happiness of his family. The group of friends were wholly in agreement to go see the new superhero movie. The Planes And Have Equations :6x3y+Z=5:X+32y+5z=5 Calculate The Angle Between The Given \( f(x)=-2 \times 3-9 \times 2+60 x+7 \). Find its critical values and its local extrema (local max and local min)