DNA Never leaves the Nucleus of the cell. This is why you need RNA. In Transcription, DNA is
transcribed into a strand of RNA.
DNA has Adenine, Thymine, Cytosine, Guanine
RNA has Adenine, Uracil, Cytosine, Guanine
Transcription of DNA to RNA
ATGCCTAAGCCGTGTCCGAT

Answers

Answer 1

Answer:

Transcription and translation are the processes by which cells read or express the genetic instructions encoded in their DNA. Because multiple identical RNA copies may be produced from the same gene, and each RNA molecule can drive the creation of many similar protein molecules, cells can swiftly create a vast amount of protein when needed. However, each gene may be transcribed and translated with varying degrees of effectiveness, allowing the cell to produce massive amounts of some proteins while producing minute amounts of others (Figure 6-3). Furthermore, as we will learn in the following chapter, a cell may adjust (or regulate) the expression of each of its genes based on the demands of the moment—most visibly by managing RNA synthesis.


Related Questions

Unlike implicit memories, explicit memories are processed by the
a. hippocampus
b. cerebellum
c. hypothalamus
d. motor cortez

Answers

The process of getting information into memory is called priming. chunking  Unlike implicit memories, explicit memories are processed by the hippocampus.

What is the role of the hippocampus during sleep?

Hippocampal activity seems to specifically support memory consolidation during sleep, through specific coordinated neurophysiological events (slow waves, spindles, ripples) that would facilitate the integration of new information into the pre-existing cortical networks.

What emotions does the hippocampus control?

The hippocampus, located in the medial temporal lobe and connected with the amygdala that controls emotional memory recalling and regulation (Schumacher et al., 2018); it has increased the functional connectivity with anterior cingulate or amygdala during emotional regulation and recalling of positive memory .

To know more about hippocampus visit

https://brainly.com/question/10068888

#SPJ4

Thermal equilibrium is attained when two objects have the
same...

a temperature
b pressure
c humidity
d heat loss

Answers

Answer:

A. temperature

Explanation:

Thermal equilibrium is attained when two objects have the same temperature. This means that the heat energy flowing from one object to another stops because the two objects have reached the same temperature. At this point, the temperature of the two objects will remain constant as long as they remain in contact with each other and no external heat energy is added or removed.

which type of secretion has an extracellular effect such as the digestion of food?

Answers

Exocrine stashing is a type of  stashing that has an extracellular effect,  similar as the digestion of food.

Exocrine  concealment are produced from technical cells and  tubes and are released into the body's external  terrain. exemplifications of exocrine  concealment include digestive enzymes, sweat,  slaver, and mucous. Digestive enzymes,  similar as amylase, protease, and lipase, are buried by the pancreas and help to break down complex carbohydrates,

proteins, and fats into simpler  motes that can be absorbed by the intestine. slaver, which is produced by the salivary glands, helps to bedew and  slick food in the mouth, while mucous helps to  cover the filling of the stomach and intestine. Sweat is buried by the sweat glands and helps to cool the body down during  violent physical  exertion. All of these exocrine  concealment serve important functions in the body and are essential for the digestion and  immersion of food.

To know more about Digestive enzymes visit:

https://brainly.com/question/30312574

#SPJ4

what separates the parietal and visceral pericardium?

Answers

The parietal and visceral pericardiums are separated by the pericardial cavity. Serous fluid lubricates the visceral and parietal membranes in this cavity.

The pericardium is made up of two layers: a visceral pericardium that adheres to the outside of the heart and a parietal pericardium that forms a fibrous layer by the visceral pericardium reflecting back on itself.

The pericardial cavity is the potential space between these two layers. The pericardial cavity is the potential space formed around the heart by the two layers of serous pericardium.

It usually contains a small amount of serous fluid, which acts to lubricate and reduce surface tension. As a result, the cavity allows the heart to move freely.

Learn more about "pericardial cavity" to visit here;

https://brainly.com/question/15072560

#SPJ4

the formation of atp as a result of the activity of the electron transport system is termed substrate-level phosphorylation. T/F

Answers

False. The synthesis of ATP as a result of electron transport system activity is not referred to as substrate-level phosphorylation.

Substrate-level phosphorylation is a kind of cellular respiration in which ATP is produced directly by transferring a phosphate group from a high-energy substrate molecule to ADP. The electron transport system is a component of oxidative phosphorylation, a kind of cellular respiration that utilises energy provided by the electron transport chain to make ATP via the activity of the ATP synthase complex.

The ATP synthase is a mitochondrial enzyme that catalyses the synthesis of ATP from ADP and phosphate, which is driven by a flux of protons across a gradient formed by electron transfer from the proton's chemically positive to negative side.

Learn more about cellular respiration at :https://brainly.com/question/29760658

#SPJ4

What is the role of RNA to provide the original blueprint for protein production?.

Answers

The function of RNA in providing the initial recipe for protein synthesis. Transmit data for protein synthesis from the nucleus to the ribosomes.

A crucial molecule for the synthesis of protein is RNA. The enzyme DNA dependent RNA polymerase aids in the conversion of DNA into RNA. Transcription is the procedure that creates the r n e.

The RNA is then sent to the ribosome, where translation transforms it into protein. This means that any shapes are the original design for producing proteins. The transcription and transfer of genetic instructions from the nucleus to the cytoplasm, where proteins are created, is one of RNA's most significant functions. RNA also performs structural, regulatory, and catalytic functions.

To learn more about RNA lick here:

https://brainly.com/question/25979866

#SPJ4

diagnostic test that measures electrical activity within muscle fibers

Answers

The electrical activity that occurs when a muscle is stimulated by a nerve is measured by electromyography (EMG). The examination is done to identify any neuromuscular anomalies.

Electromyography (EMG) detects the electrical activity that occurs when a neuron stimulates a muscle. The test is used to identify aberrant neuromuscular function. One or more tiny needles, commonly known as electrodes, are introduced through the skin and into the muscle during the test. An oscilloscope is then used to display the electrical activity that the electrodes picked up (a monitor that displays electrical activity in the form of waves).

In order to hear the activity, an audio amplifier is employed. The electrical activity of muscles during rest, a light contraction, and a strong contraction is measured by EMG. At rest, muscle tissue doesn't typically create any electrical signals. There is a brief period of activity when an electrode is introduced, but there is no signal beyond that.

To learn more about Electromyography visit;

https://brainly.com/question/29894069

#SPJ4

____increases the surface area available for absorption of materials across the cell membrane.

Answers

The surface area available for material absorption across the cellula membrane is increased by the presence of microvilli on a cell's surface.

Numerous cells in the body have cellular menbrane extensions, which might be cilia or microvilli, the shortest, depending on their length. We can observe the case of the small intestine's microvilli, which are more prevalent at the level of the second and third segments of the gut, favouring the significant absorption of liquids, proteins, and nutrients that take place at these levels. We may locate these cilia in the cells of the respiratory system and the reproductive system, where they aid in the mobility of foreign bodies (respiratory system) and the movements of sperm. They are shown as an appendix in the shape of hair (reproductive system).

Learn more about cellular membrane here:

https://brainly.com/question/14489874

#SPJ4

White-tailed deer are mammals. Mammals have a reproductive strategy
that is not found in all animals.
Which two statements provide a cause and effect of the reproductive
strategy of white-tailed deer that helps them survive?
A. It requires two parents.
B. It requires only one parent.
C. It causes very fast growth and development.
D. It produces genetic variation within a population.
E. It results in individuals being identical to one parent.

Answers

I think the answer is A and D.

Cold water rie from the bottom of the ocean to the urface of the ocean at different place around the globe

Answers

Cold water rises to the surface of the ocean from its depths through a process known as upwelling, which occurs in various locations across the world. In this case, Option 3 is correct.

Upwelling: What is it?

Upwelling is an oceanographic phenomenon that involves the movement of waves of dense, colder, and frequently nutrient-rich water from deep water toward the ocean's surface. In place of the warmer, frequently nutrient-depleted surface water, the cold water plays that part.The process of upwelling is responsible for bringing deep, cold water currents to the ocean's surface. Upwelling is influenced by both the planet Earth's winds and rotation. Deep, chilly ocean water is brought to the surface through an action known as upwelling. Winds and the rotation of the Earth cause upwelling.

To know more about upwelling visit:-

brainly.com/question/12267427

#SPJ4

Question:-

Cold water rises from the bottom of the ocean to the surface of the ocean at different places around the globe. What is this process called? global warming climate change upwelling cold water current



On about June 21st, the Sun is directly overhead at the Tropic of
23.5 degrees
latitude.
IL
solstice.
hemisphere is tilted directly away
solstice?

Answers

On June 21st, the Sun is directly overhead at the Tropic of Cancer (23.5 degrees latitude).

What do you mean by Tropic of Cancer?

The Tropic of Cancer is a latitude on the Earth's surface, marking the most northerly point at which the sun can be directly overhead at noon. It is currently located at approximately 23.5 degrees north latitude. This line marks the northern boundary of the tropical zone and separates the tropical and temperate zones of the Earth.

On June 21st, the Sun is directly overhead at the Tropic of Cancer (23.5 degrees latitude) during the summer solstice in the northern hemisphere. This marks the longest day of the year for the northern hemisphere and the beginning of summer. It is also when the northern hemisphere is tilted directly towards the Sun, receiving the most direct sunlight. At the same time, the opposite is happening in the southern hemisphere, where it's the winter solstice and the shortest day of the year, as the southern hemisphere is tilted away from the Sun.

To know more northern hemisphere visit:

https://brainly.com/question/26841745

#SPJ1

How are Darwin's finches an example of natural selection?.

Answers

Darwin's finches are an example of natural selection by observed thаt beаk shаpe vаries аmong finch species.

Dаrwin’s finches аre аn excellent exаmple of the wаy in which species’ gene pools hаve аdаpted in order for long-term survivаl viа their offspring. Their beаks hаve evolved over time to be best suited to their function. For exаmple, the finches who eаt grubs hаve а thin extended beаk to poke into holes in the ground аnd extrаct the grubs. Finches who eаt buds аnd fruit would be less successful аt doing this, while their clаw-like beаks cаn grind down their food аnd thus give them а selective аdvаntаge in circumstаnces where buds аre the only reаl food source for finches.

For more information about natural selection refers to the link:

https://brainly.com/question/2725702

#SPJ4

how is cte different from tbi

Answers

cte stands for chronic traumatic encephalopathy. it’s a deadly disease that progresses over time. cte is caused by multiple tbi’s

tbi stands for traumatic brain injury. it can be caused by multiple hits to the head and or concussions. tbi’s are credited as being a early sign of dementia

hope this helps

Does Claire have a miscarriage in the books?.

Answers

Claire delivered her child too soon as a result of the anguish of seeing Jamie and Black Jack Randall (Tobias Menzies) engage in combat.  

While rushing to stop Jaime from dueling Captain Jack Randall, Claire sadly lost her child after going into early labor. When the nurse's baby was stillborn at Hospital Des Agnes after being transported there, Claire was heartbroken. Whether Jamie sought BJR or not, Claire knew she would have miscarried because she had experienced bleeding in the weeks prior to it as well as a bothersome backache when traveling to Bios de Bologna. She didn't hold herself responsible for the miscarriage. It's simple to love Claire and Jamie while they're in love, but it's quite another to witness Balfe's character say she "hated" Jamie for the things that happened that tragically resulted in the miscarriage of their first child.

Learn more about Miscarriage here:

https://brainly.com/question/29547783

#SPJ4

What are 3 mutations and describe each?.

Answers

Three mutations are deletion, insertion and substitution.

Substitution mutation:In the context of genomics, substitution is a type of mutation in which one nucleotide is switched out for another. Additionally, the phrase can be used to describe the substitution of one amino acid for another in a protein.

Deletion mutation:Kind of self-explanatory, deletion. It occurs when a base is removed or, to put it another way, is simply absent.

Insertion mutation: Insertion denotes the addition of a new nucleotide.

Learn more about nucleotide from:

https://brainly.com/question/16308848

#SPJ4

what are carbohydrates used for within the cell membrane_____

Answers

Cell membranes also include carbohydrates that are covalently attached to proteins or lipids, which serve as sites for cell adhesion and addressing.

What three tasks does the cell membrane perform?

The membrane organelles play a key role in many cellular processes, such as nutrition intake and conversion, chemical synthesis, energy production, and regulation on metabolic pathways.

What are the cell membrane's four primary roles?

Identification, communication, control of solute exchange across the membrane, & isolation of a cytoplasm from the surrounding environment are the four primary roles of the plasma membrane.

To know more about carbohydrates visit:

https://brainly.com/question/29775112

#SPJ4

all of the processes associated with obtaining and processing food, using absorbed nutrients to generate cellular energy, and the elimination of waste, are described by the term , which includes all of the life-supporting chemical reactions that cells perform.

Answers

All of the processes associated with obtaining and processing food, using absorbed nutrients to generate cellular energy, and the elimination of waste, are described by the term metabolism.

What is metabolism?

Metabolism is the set of life-sustaining chemical reactions within the cells of living organisms. These reactions allow organisms to grow, reproduce, respond to their environment, and maintain homeostasis. Metabolism involves the breakdown of complex molecules, such as proteins, carbohydrates, and lipids, into simpler molecules, and the use of these simpler molecules to build new molecules.

Therefore, All of the processes associated with obtaining and processing food, using absorbed nutrients to generate cellular energy, and the elimination of waste, are described by the term metabolism.

To learn more about metabolism

Here: https://brainly.com/question/1792495

#SPJ4

What colors do leaves absorb and reflect?.

Answers

Except for green, these pigments absorb all visible light. They absorb more red and blue wavelengths. The plants reflect greenlight, giving them a green appearance.

Chloroplast contains chlorophyll, also known as photosynthetic pigment, which, along with other pigments in the plant cell, plays an important role in the plant's color component.

Plant cells are eukaryotes, but they are not the same as animal cells. The structures that distinguish a plant cell are the cell wall, which serves as a support and filter, a plastid, which contains the plant's color components, and vacuoles.

Green plants are so because of a pigment called chlorophyll. Chlorophyll absorbs light at specific wavelengths in the visible light spectrum.

To know more about chloroplast click here,

https://brainly.com/question/11136550

#SPJ4

the plasma membrane of cells is selectively permeable.T/F

Answers

True - some molecules can cross while others cannot.

Is the plasma membrane of a cell porous or impermeable?

The fact that membranes control what enters and exits a cell is their primary function.The membrane is partially permeable because no specific chemicals pass through it.Some chemicals, including oxygen and hydrocarbons, can pass through the membrane.

Where is the cell membrane's selective permeability located?

Proteins, lipids (cholesterol & phospholipids), and carbs make up the majority of selectively permeable.

To know more about molecules visit:

https://brainly.com/question/19922822

#SPJ4

You examine an articulated skeleton in the laboratory and determine the skeleton to be a female since ________.

Answers

You examine an articulated skeleton in the laboratory and determine the skeleton to be a female since it has a wide pelvis and narrow shoulders.

What is skeleton?

Skeleton is a basic structure or framework of a human body, often represented as a simplified diagram of bones, muscles, and organs. It serves as a foundation for the body and provides it with support, stability, and shape. The bones of the skeleton also protect vital organs, store minerals, produce blood cells, and allow movement. The main components of the human skeleton are the axial skeleton, which includes the skull, spine, and rib cage, and the appendicular skeleton, which includes the arms, legs, and pelvis. Additionally, the skeleton also contains numerous ligaments, tendons, and joints.

To learn more about skeleton
https://brainly.com/question/27960676
#SPJ4

What kind of gene mutation is more likely to result in a nonfunctional protein and why?.

Answers

Frameshift gene mutation. A protein's inability to function is more likely to result from a frameshift mutation than from a point mutation. This modifies the nucleotide bases in codons, changing their base sequence.

Frameshift gene mutation changes the amino acid sequence and the proteins that come after it. Changing the way a DNA sequence is read, for as through an insertion or deletion, can result in a frameshift mutation, a specific kind of genetic modification. A change in the reading frame occurs when one or more nucleotides are added or deleted. Cystic fibrosis is caused by two frameshift mutations in the CFTR genes, one of which results in the insertion of two nucleotides and the other in the deletion of one.

Learn more about gene mutation here:

https://brainly.com/question/462225

#SPJ4

What are the main reasons of mutation stop codon?.

Answers

The substitution of a single base pair in a triplet codon causes nonsense mutations, which result in one of three stop codons (UAG, UAA, and UGA)

As a result, the triplet codon for an amino acid is changed to one that causes mRNA translation to end too soon and causes a truncated protein.

Because stop codons do not encode for an amino acid but rather mark the completion of protein synthesis, they are also known as nonsense codons. So, prematurely introducing a nonsense or stop codon into the DNA sequence results in nonsense mutations. In general, a stop codon—UAA, UAG, or UGA—in the ribosome's A site is a signal to stop protein synthesis. As it assures the production of complete proteins, this procedure is the final crucial step in the translation process.

To learn more about mutation stop codon click here:

https://brainly.com/question/30279740

#SPJ4

this tissue type is made up of cells that can contract.

Answers

Muscle tissue is made up of cells that can contract , All sorts of organs can move thanks to the contraction and relaxation of the cells that make up muscle tissue.

Option B is correct.

Muscle Tissue:

Muscles a collection of muscle fibers that can contract and relax to move various body parts. The digestive tract, eyelids, blood arteries and ducts, cardiac (heart) muscle, and skeletal (limbs, trunk, jaw, and face) muscle are all examples of smooth muscle.

Could the epithelial tissues contract?

Epithelial tissues can frequently be compared to flexible, active solids. The ability of individual cells within the tissue to contract and/or alter their mechanical characteristics in response to a variety of conditions demonstrates their active nature.

Does only muscle tissue have the ability to contract?

Muscle tissue is the only kind of tissue in the body that can contract. The specialization of muscle tissue enables it to contract, or shorten, to enable movement of various body parts. Muscle is made up of three main types: smooth, skeletal, and cardiac

Incomplete question:

this tissue type is made up of cells that can contract.

A .nervous tissue

B .muscle tissue

C .connective tissue

D .epithelial tissue

Learn more about Muscle tissue :

brainly.com/question/11954413

#SPJ4

Which is responsible for bone growth and change?

Answers

Answer: Osteoblasts, osteocytes and osteoclasts

Explanation:

_____ link the nutrient-supplying capillaries to neurons and control the chemical environment to protect the neurons from any harmful substances in the blood.

Answers

Astrocytes link the nutrient-supplying capillaries to neurons and control the chemical environment to protect the neurons from any harmful substances in the blood.

Astrocytes protect neurons from potentially harmful blood components by regulating the chemical environment and linking the capillaries that supply nutrients to the neurons. microglia consumes and excretes dead cells and microbes.

In general, the brain is made up of three main types of neurons, each of which serves a different purpose. Sensing neurons, which affect the cells of the sensory organs, send messages to the spinal cord or brain in response to stimuli like touch, sound, or light. Motor neurons receive instructions from the brain and spinal cord, which in turn control everything from glandular secretion to muscle contractions. Interneurons connect neurons in the same part of the brain or spinal cord. A grouping of numerous neurons is referred to as a "neural circuit."

To learn more about neurons click on the given link: brainly.com/question/29462317

#SPJ4

What is meant by the statement that science is a way of thinking explain?.

Answers

The statement science is a way of thinking means that science is the way that helps one to learn and think to solve real-world problems.

Asking questions, testing hypotheses, making observations, spotting patterns, and concluding are all examples of the intentional information searching that goes into scientific thinking. Science is the methodical investigation of the physical and biological characteristics as well as the structure and operation of the natural world. It is a comparatively modern approach to learning about natural events, having largely displaced the influences of less objective techniques and viewpoints.

So it is both a body of knowledge and a method of learning new things. For example, scientists have a clear understanding of the problem at hand and the question that needs to be answered. They challenge facts, judgments, and worldviews. They try to be precise, accurate, and relevant.

To know more about scientific thinking:

https://brainly.com/question/617174

#SPJ4

Select all the algebraic expreion equivalent to m5n5. (mn–1)5
(mn)5
[(mn2)]–3
(mn)–5
m5n–5

Answers

From the given algebraic expressions the ones which are equivalent to m^5/n^5 are (mn^–1)^5 and m5n–5.

Given the algebraic expression m^5/n^5

We can express this in other way by multiplying the numerator with n^-5 such that m^5 x n^-5/ n^5 x n^-5 = m^5 x n^-5 = (m x n^-1)^5

In other way we can directly take the denominator to numerator as:

m^5 x n^-5

Any other like terms on either side of the equation should be mixed with the X-terms and constants. The x-term is typically placed before the constants when arranging the terms in the same sequence. If and only if each of the terms in the two sentences is the same, the phrases are equal. The five categories that follow enable further categorization of various algebraic expression forms.

To learn more about algebraic expressions click here https://brainly.com/question/953809

#SPJ4

complete question: Select all the algebraic expression equivalent to m^5/n^5.

(mn^–1)^5

(mn)^5

[(mn^2)]^–3

(mn)^–5

crossing over occurs at the ends of chromosomes, rather than near the centromeres.

Answers

Crossing over occurs at the ends of the chromosomes, not close to the centromeres, where DNA segments can easily break and reattach.

Option 2 is correct

Where exactly does chromosome crossing occur?

During the pachytene phase of meiosis, when pairs of chromosomes are fully coupled, crossing occurs.  At diplotene, after homologs divide, the locations of trying to cross become visible as cytokinesis, which holds the two homologs of a pair together until segregation during anaphase I.

Which of the following is true regarding crossing over?

Genes are exchanged at random between the parents' chromosomes. During the crossing-over process, gametes generate novel gene combinations.

Question incomplete:

What are the requirements and consequences of crossing over?

1. For crossing over to occur, homologous chromosomes must align precisely early in prophase I so that nonsister chromatids can exchange corresponding segments of DNA.

2. Crossing over occurs at the ends of chromosomes, rather than near the centromeres, because segments of DNA near the centromeres cannot break and rejoin easily.

Learn more about chromosome:

brainly.com/question/1596925

#SPJ4

how many branches represent the domains on the evolutionary tree of life?

Answers

Three branches represents the domains on the evolutionary tree of life

the secondary structure of a protein results from _____.

Answers

The secondary structure of a protein results from hydrogen bond.

The secondary structure of a protein results from the  conformation of hydrogen bonds between the backbone  tittles of the polypeptide chain. Hydrogen bonds are  veritably weak, but  inclusively they can stabilize certain patterns of the polypeptide chain which give the protein its shape. There are two main types of secondary structures α- helices and β-  wastes. α- helices are formed when the polypeptide chain is  curled into a spherical shape.

Hydrogen bonds form between the amide groups of the peptide backbone and  produce a  spiral structure. β-  wastes are formed when two or  further polypeptide chains twist around each other. The hydrogen bonds form between the amide groups of the two polypeptide chains, creating a  distance- suchlike structure.

To know more about polypeptide chains visit:

https://brainly.com/question/22664176

#SPJ4

Other Questions
a possible benefit of Chinese composers borrowing Western musical techniques Which parallelograms have the same area? What is that area? Sheffield Company assigns overhead based on machine hours. The Milling Department logs 2400 machine hours and Cutting Department shows 4150 machine hours for the period. If the overhead rate is $4 per machine hour, the entry to assign overhead will show a debit to Work in Process for $16600. credit to Manufacturing Overhead for $26200. credit to Work in Process -Cutting Department for $16600. debit to Manufacturing Overhead for $26200. Which of the following would apply to the legal standard if there is no written record of a temperature, a visit, a history, physical, or a lab report?a. it was not written down, so it did not happenb. the court will take the patient's word for itc. the court will take the provider's word for itd. the court will make the decision as to whether or not it happend italian actress gina lollobrigida died at 95. what did she pursue after she left acting? A mother is 66 inches tall, and her daughter is 33 inches tall. Which of the following equations describes the relationship between m, the height of the mother, and g, the height of the daughter?A. g=2/mB. g = 2mC. g=m/2D. g=m-2 4. A shop is having a five-day sale. on Monday, the price will drop by previous day's price. For example price of a product is $20, then the Monday would be $18 (that's 10% original price), and on Tuesday it (that's 10% less than Monday's p Develop a solution that will calcul item for each of the five days, giv price. Test the solution for an item points) Your solution should include: -PAC -Algorithm You will need a "for loop" that iterates each iteration, the item price will be u the sale amount. attempts to use reorganization as a chance to pursue own interests and goals is a political behavior resulting from which of the following conditions? One U.S. dollar trades for 110 yen. Which of the following correctly explains the effect on Japanese automobile prices for holders of U.S. dollars if the U.S. dollar appreciated relative to the yen?A) Since one U.S. dollar is worth fewer yen, Japanese automobiles are relatively more expensive to holders of U.S. dollars.B) Since one U.S. dollar is worth fewer yen, Japanese automobiles are relatively less expensive to holders of U.S. dollars.C) Since one U.S. dollar is worth more yen, Japanese automobiles are relatively less expensive to holders of U.S. dollars.D) Since one U.S. dollar is worth more yen, Japanese automobiles are relatively more expensive to holders of U.S. dollars. Give three uses of sub-directors or subfdders You are driving up to New York City, and the PM2.5 concentration is 23 micrograms per cubic meter. At what distance will you begin to see the skyline of Manhattan? frederick douglass failed twice at escaping. 80% of slaves could not read and write, as it was against the . What type of information is commonly included in the owner's manual that would be a benefit to the service technician?O Maintenance items specificationsO Tire pressure monitoring system reset proceduresO Maintenance reminder light reset proceduresO All of the above Now that Amazon does collect sales tax in most states, what other loopholes has Amazon found to evade other taxes? fred, a linux administrator, needs to create the directory /var/oracle/database/9i. only the directory /var currently exists. the current working directory is the root of the filesystem.which of the following commands will create the directory path? Explain / interpret the following artwork baed on the viewer context and artit context Salubong NEED BY 10pm TODAY Dont give me your freedom and integrity stand for something or youll fall for anything today mighty oak is Yesterdays not that held its ground.-Rosa parks1. Why do you agree or disagree with the statement? why?2. What does it mean to take a stand?3. Why do some people choose to take action to address the wrong while others choose to stand by and watch?4. What are challenges and risks involved when someone takes a stand? In which of the following stages of the consumer buying decision process does a person use evaluative criteria to assess a consideration set?a. evaluation of alternativesb. post purchase evaluationc. information searchd. purchasee. problem recognition How do you write a short poem step by step?. One dimension of Quality is product Performance. Match the customer expectation result with the different performance relationship:MeetsExceedsDoes not meetPerformance < ExpectationsPerformance > ExpectationsPerformance = Expectations