GIVING BRAINLIEST do crocodiles go in salt water

Answers

Answer 1

Answer:

Yes, Crocdiles are found in both salt and fresh water

Explanation:

Answer 2

Answer:

Yes

Explanation:


Related Questions

Plsss helppp plllsss helppp

Answers

Answer:

A

Explanation:

A solution with a pH lower that 7.0 is acidic, so that narrows the answers down to a and d. OH- is a base and H+ is acidic, so the answer is A

Answer:

I cant really read it, its kinda blurry.

Explanation:

Are fungi Producers or Consumers?

Answers

Answer:

Bacteria and fungi are actually decomposers. They eat decaying matter - dead plants and animals and in the process they break them down and decompose them.

Fungi it’s a decomposer because it decomposes the bodies of dead plants and animals.


What is the function of an enzyme? CHECK ALL THAT APPLY

Answers

Answer:

this is less helpful for you

Enzyme is a biocatalyst type of protein which can increase the rate of chemical reaction by reducing activation energy.

What are the properties of an enzyme ?

Enzymes are protein catalysts which enhance  the rate of biochemical reactions, it is pH-specific, catalyze both forward and reverse type of biochemical reaction but do not determine in which direction the reaction goes.  

An enzyme have active site where the substrate bound to form desired product and the enzyme increase the rate of reaction by reducing the activation energy.

Several factors which shows their effect on the action of the enzyme like heat, temperature and varying pH, it shows absolute, relative, group, stereo-specificities and regulatory function.

The Physical properties of enzyme include  act as colloid and inactivated below boiling point of water, are thermos-labile which can withstand temperatures of 100 degrees.

Learn more about enzyme, here:

https://brainly.com/question/1419573

#SPJ6

Medium required for activity of pancreatic enzymes is

Answers

Answer:

Pancreatic juice requires alkaline medium for their action. The reason of its alkalinity is due to the presence of bicarbonate ions. Bicarbonates are used to neutralize the acidic gastric acid.

organisms that have many characteristics in common are grouped into a _______?

Answers

Organisms that have many characteristics in common are grouped into a ’species’ - hope this helped :)

Answer:

The are grouped in species...

SCIENCE- help me please I have to turn this in tonight PLEASE.............

Answers

Answer:

Yes,if it has a large mass it will have a large weight Awnser (2)

What process maintains a stable internal condition, despite changes in the external environment?

A) Metabolism
B) Reproduction
C) Respiration
D) Homeostasis

Answers

Answer:Homeostasis

AP Biology

Answer:

D

Explanation:

What kind of mineral ID is this?

please hurry !! thank you :)

Answers

Answer:

Cleavage and Fracture

Explanation:

Cleavage is the way a mineral breaks. Many minerals break along flat planes, or cleavages—some in only one direction (like mica), others in two directions (like feldspar), and some in three directions (like calcite) or more (like fluorite). Some minerals, like quartz, have no cleavage. Cleavage is a profound property that results from a mineral's molecular structure, and cleavage is present even when the mineral doesn't form good crystals. Cleavage can also be described as perfect, good or poor.

3. Write the complimentary sequence of DNA for the following strand:
5'-AATTAGGAGCCCAGCTTTGCCGA-3'

Answers

The correct answer is TTAATCCTCGGGTCGAAACGGCT

This is because whenever you’re trying to find the complementary sequence of DNA, you basically switch which the listed base and it’s correspondent.

Adenine -> Thymine
Cytosine -> Guanine

Hope this helps!! :)

Question 6 (Multiple Choice Worth 5 points)
(01.01 LC)
Which career is in the field of agriscience?
Pediatrician
O Food scientist
O Mayor
Athletic trainer

Answers

Answer:

food scientific

Explanation:

application of scientific principles to agriculture. so food scientific to make short.

Answer: Food science

Explanation: Agriscience is the study of agriculture, natural resources, animal science, plant science (horticulture), and food science.

I will give brainliest!!!

You're looking through a microscope at a eukaryotic cell and notice that its genetic material (DNA) is openly floating around the cytosol.

What could be a possible cause for what you're seeing through the microscope?

Choose 1 answer:

(Choice A)
A
The lysosome is damaged.

(Choice B)
B
The nucleus is damaged.

(Choice C)
C
The vacuole is damaged.

(Choice D)
D
There is no cause; genetic material should be floating around the cell in this manner.

Answers

Answer:

B. The nucleus is damaged.

Explanation:

Eukaryotic cells contain a membrane-bound nucleus and numerous membrane-enclosed organelles. DNA is present in the nucleus of the cell. If the nuclear membrane is ruptured/damaged then the nucleoplasm along with the DNA will openly float around the cytosol.

Answer: The nucleus is damaged.

Explanation: The nucleus is supposed to keep genetic material (DNA) housed within its membrane-bound structure, but in this cell, the genetic material is openly floating around the cell's cytosol. Have a nice day :)

what is a scientific question

Answers

A question that is based on observations and that is testable

Explanation:

dictionary

Answer: a question that is based on observations and that is testable

Explanation: Hope this helps :)

Which of the following could be a sequence in the carbon cycle?

Answers

Answer:

plants take in carbon dioxide and produce glucose --> animals consume plants --> animals break down glucose and release carbon dioxide

Explanation:

The carbon cycle is the sequence through which carbon is cycled through ecosystems. The carbon cycle usually occurs in the following order:

First, plants take in carbon dioxide and convert it to glucose.

Then, animals consume plants and break down glucose through the process of respiration.

Finally, this process releases carbon dioxide back into the atmosphere, and the cycle continues.

Why is it beneficial for the earth to have both autotrophic and hypertrophic?

Answers

Because it will create balance on the earth. For example if there are only autotrophs there will be competition for nutritious and space for the roots to grow .Also for the heterotrophs, the harbivous will be hard for them to find plants to eats eventually it will lead to starvation then death and their death will affect carnivores because the organisms that they used to hunt are all dead now. So when there is a balance between autotrophs and heterotrophs they will help each other to survive.

This is a timeline depicting the development of atomic ___________. What word should be used to fill in the blank? Support your choice with evidence. A) Law. At each interval on the timeline, scientists described the patterns they saw in both atomic and subatomic structure. Eliminate B) Law. Scientists used observation, experimentation, and mathematical models to explain atomic stricter and the behavior of subatomic particles. C) Hypothesis. Scientists conducted experiments at each interval. They made educated guesses regarding atomic structure and then experimented to support or rejected the hypotheses. D) Theory. At each interval on the timeline, scientists made observations and conducted experiments to explain how atoms and/or subatomic particles behaved in order to determine atomic structure.

Answers

Answer:

Subatomic particle, also called elementary particle, any of various self-contained units of matter or energy that are the fundamental constituents of all matter. Subatomic particles include electrons, the negatively charged, almost massless particles that nevertheless account for most of the size of the atom, and they include the heavier building blocks of the small but very dense nucleus of the atom, the positively charged protons and the electrically neutral neutrons. But these basic atomic components are by no means the only known subatomic particles. Protons and neutrons, for instance, are themselves made up of elementary particles called quarks, and the electron is only one member of a class of elementary

Explanation:

because it is

it's d lol

Theory. At each interval on the timeline, scientists made observations and conducted experiments to explain how atoms and/or subatomic particles behaved in order to determine atomic structure. Let's take one example: Rutherford's gold foil experiment. Based on observing the behavior of alpha particles directed at a gold foil screen, Rutherford determined that an atom consisted of mostly empty space, with all of its positive charge concentrated in its center in a very tiny volume, surrounded by a cloud of electrons. Yet, further experimentation eventually lead to another model and another theory of atomic structure.

​Which of the following structures are found in eukaryotes, but not prokaryotes?

Choose 1 answer:

(Choice A) Golgi body

(Choice B) Cytosol

(Choice C) Cilia

(Choice D) Cell membrane

Answers

i’m pretty sure the answer is A

The structures that are found in eukaryotes, but not prokaryotes are:

Golgi bodyCilia. Both prokaryotic and eukaryotic cells contain cytosol and cell membrane structures.

The Golgi apparatus is known as a cellular organelle whose function is to handle the proteins synthesized by the endoplasmic reticulum.

It is found in eukaryotic cells and is responsible for completing the production process of certain proteins.

Cilia are a series of short and numerous mobile extensions of the plasma membrane that line the cell surface of some eukaryotic cells.

Prokaryotic cells form living unicellular organisms, they present their genetic material dispersed in the cytoplasm, because they lack a cell nucleus.

Its cell membrane is responsible for delimiting the organism, which also lacks any type of organelle or cell divisions.

Therefore, we can conclude that the structures that are found in eukaryotes, but not prokaryotes are: Golgi body and Cilia and both prokaryotic and eukaryotic cells contain cytosol and cell membrane structures ..

Learn more here: https://brainly.com/question/776836

Which of the following is a function of proteins? (AKS 1a)
O A.
A. long term energy storage
O
B. help with slowing down chemical reactions
O
C. build tissues such as bone and muscle
O
D. raise activation energy and lower reaction rate

Answers

Answer:

ans is A long term energy

storage

Long term energy storage

If a squirrel climbs a tree at 16m/s how many meters will it travel every hour ? ____ m/hr

Answers

Answer:

57600

Explanation:

16x60x60

Brainiest please :D

The distance travelled per hour by the squirrel as it climbs a tree at 16m/s is :  57600m/hr

Determine the distance travelled every hour

Given data :

velocity = 16m/s

To determine the distance travelled per hour

16 m * 60secs * 60 minutes

= 16 * 60 * 60

= 57600 m

Hence we can conclude that the The distance travelled per hour by the squirrel as it climbs a tree at 16m/s is :  57600m

Learn more about Velocity : https://brainly.com/question/4931057

#SPJ2

What does a targeted digestive capsule mean?

Answers

Targeted to help just that the (digestive system) a digestive capsule is a coated tablet that is digested

I will give brainliest!!!!!!!
Protein synthesis can occur on the rough endoplasmic reticulum (ER) but not on the smooth ER.

Which cell structures are attached to the surface of the rough ER that allow it to make proteins?

Choose 1 answer:

A
DNA strands

(Choice B)
B
Vacuoles

(Choice C)
C
Chloroplasts
(Choice D)
D
Ribosomes

Answers

Answer:

The answer is b

Describe a non-biological hierarchy that exists in everyday life and how it relates to a biological system.


Answers

Answer:

A non-biological hierarchy could be the way the military is organized, with the soldiers at the very bottom and the big commanders on top. (I don't know the specific names for each of them) This relates to a biological heirarchy since the smaller, sadly less important things are at the bottom, like atoms and soldiers, and each group of soldiers makes a regiment (which would be a molecule), then a battalion (which would be a cell), then so on. (I dont know the order of the groups but you can look it up)

Which organelles are found in plant cells but not in animal cells?

Answers

Answer:

Organelles that are found in plant cells, and not in animal cells, are chloroplasts, a call wall, specialized plastids, and a large central vacuole.

Hope you found this helpful <3

Answer:

cell wall and chloroplast

Explanation: hope this helps:)

NEED HELP ASAP!!!!

In trying to prove continental drift, Alfred Wegener used evidence from long ago to show that in the distant past, similar animal species lived in places that are ______today. For example, fossils of the________ were found in India, Africa, and Antarctica.

Answers

Wegener used Gondwana glaciation evidence, lithological and structural evidence, plates fitting together, and paleontological evidence to prove his theory. 1) separated 2)  Lystrosaurus.

What evidence used Wegener to prove his theory?

Since Wegener’s theory about continental drift was seriously criticized, he used a list of 10 pieces of evidence proposed by the geologist Du Toit that supported his theory.

The list includes Gondwana glaciation evidence, lithological and structural evidence, plates fitting together, and paleontological evidence.

Among the paleontological evidence, plant and animal fossils from the same species were found in currently separated continents. This distribution suggests the existence of a big unique supercontinent where these species used to inhabit.

For instance,

Glossopteris (fern) impressions are widely distributed in determined areas of Africa, South America, India, and Australia.

Terrestrial vertebrate fossils also support the theory. The presence of Triassic tetrapods in all continents suggests terrestrial corridors between landmasses.

Lystrosaurus ⇒ Triassic reptile ⇒ Found in Africa, India, and Antarctica

⇒ Mesosaurus ⇒ Triassic reptile ⇒ Found in South America and Africa

⇒ Cygnonathus ⇒ Triassic reptile ⇒ Found in South America and Africa

Finding these fossils on current different continents suggests that these landmasses were once together, and these species used to live in the same region.

With time, continents diverged and got separated by the ocean. The region where these species used to live got divided and fossils got separated.

In trying to prove continental drift, Alfred Wegener used evidence from long ago to show that in the distant past, similar animal species lived in places that are _separated_today. For example, fossils of the_Lystrosaurus_ were found in India, Africa, and Antarctica.

1) Separated

2) Lystrosaurus

You can learn more about Wegener evidences at

https://brainly.com/question/839947

https://brainly.com/question/9444622

#SPJ1

why did europeans want to conquer the new world ?

Answers

Answer:

Europeans wanted to explore the world so that they could gain wealth. European rulers fought many wars and they were very expensive so they needed to find gold, silver and precious stones to pay for them.

Explanation:

Who was the first person to see cells under the microscope and give them name a Robert Hooke b Theodor Schwann c Anton van Leeuwenhoek d Matthias Schleiden

Answers

Answer:

a) Robert Hooke

Explanation:

The cell was first discovered by Robert Hooke in 1665, which can be found to be described in his book Micrographia. In this book, he gave 60 'observations' in detail of various objects under a coarse, compound microscope.

The first person to observe the cell under the microscope is Robert Hooke, who is present in Option a. Robert Hooke is the person who first observed cork cells under the microscope and gave them a name. Option a is correct

What is a cell?

In the early stages of the earth, cells were not as developed as those of today's eukaryotes; they had RNA as genetic material, and later by evolution, today's eukaryotic cells developed. Those RNA-containing cells were extremely susceptible to mutation, whereas today's DNA-containing cells are not.

The eukaryotic cell contains numerous organelles that perform various functions, such as the lysosome, which degrades pathogens, the chloroplast of plants, which perform photosynthetic reactions, the nucleus of eukaryotic cells, which conserves DNA, and the mitochondria, which generate energy through cellular activities.

Hence, the first person to observe the cell under the microscope is Robert Hooke and gave them a name, who is present in Option a.

Learn more about the cell here.

https://brainly.com/question/12129097

#SPJ5

Accuracy is a measure of how close a value is to its true value. You can control accuracy by choosing the appropriate tool or instrument and using it carefully. How could the students in the following questions improve their accuracy? Tyrrell wanted to measure the growth of tomato plants in response to different types of fertilizer. Which tool would be most accurate?

Answers

Answer:Metric ruler

Explanation:

Answer:

1. Metric ruler

2. a pH meter can distinguish smaller differences in pH as compared to a pH strip.

Explanation:

Got those right on edge ;)

Which of the following most likely causes the rate of a chemical reaction to increase? (5 points) Decreasing the reaction temperature Slowing down the reacting molecules Taking away heat from the reaction Adding heat to the reaction

Answers

Answer:

Adding heat to the reaction

Explanation:

heat increases the kinetic energy of the reacting molecules thereby increasing the rate of reaction.

Answer:

D.adding heat to the reaction

Explanation:

i got it right on the quiz

1. What makes water so unique?

Answers

Answer:

It is the reason the sky is blue

Explanation:

water helps you live, literally.

Kayla’s family has a history of high blood pressure. High blood pressure can lead to serious health problems such as heart disease. Which statement best explains why Kayla can avoid getting heart disease?

A. Genotypes that are related to high blood pressure are not inherited.
B. Phenotypes that are related to high blood pressure are not inherited.
C. The genotype of high blood pressure can be changed.
D. The phenotype of high blood pressure can be change.

Answers

Genotypes=genetic makeup
Phenotypes= physical characteristics
You can not change your genetics, so that means C is out!
Said genotypes are usually inherited as well so A is out.
I’m not 100% sure but i would deduce the answer is B

what is the role of rabbit in food chain ?​

Answers

Answer:

Rabbits are herbivores

Explanation:

Rabbit are herbivorous and directly depends on the green plants generally grasses for supply of food and energy. It is found at the second position in the foodchain. We can say that the rabbit is primary consumer in food chain. It is also link between the foodchain of grassland and forest.

Answer:

The controller that keeps plant life in check

Explanation:

Other Questions
-5n + 31 = -14n - 5 what is the equation Which two terms are associated directly with the way an annuity is funded?A) Renewable or convertible.B) Single payment or periodic payments.C) Increasing or decreasing. D) Level of flexible. What are the four major categories of micromolecules? Describe the basic structures and the primary functions of each. What did King George III issue that did not allow the colonists to move past the Appalachian Mountains? 13(2x - 1) - 3(9x + 8) = 10Quick help? The number 27 raised to which power will equal 3 What is the base number for the system of units ? In other words by what number do we multiply to move up in scale ? _____ Which statement is true regarding the graphed functions?On a coordinate plane, a red curved line with an upward arc, labeled g of x, crosses the x-axis at (negative 2, 0), and the y-axis at (0, 4). A blue curved line with an upward arc, labeled f of x, crosses the y-axis at (0, 4) and the x-axis at (2, 0). Reactant P contains 50 J of energy, and reactant Q contains 35.3 J of energy. The reactants combine to form product PQ, which contains 104 J of energy. What is the energy transformation? Energy is absorbed because the product has more energy than the reactants have. Energy is absorbed because the product has less energy than the reactants have. Energy is lost because the product has more energy than the reactants have. Energy is lost because the product has less energy than the reactants have. what was one effect of the great awakening? In the above diagram, what terms accurate label numbers 1, 2, and 3? heat, radiant, chemical radiant, heat, chemical radiant, chemical, heat chemical, radiant, heat . Which of the following is most directly responsible for the variation in seasonalweather patterns? Question 1 of 10Lipids and proteins are both types of what?A. ElementsB. CarbohydratesO C. AtomsO D. Macromolecules The value of the boiling point elevation constant (Kb) depends on the identity of the:_______. a. solute b. solvent c. most important solvent-solute interaction d. ions formed upon solution of an electrolyte e. solute and solvent Does solubility change with ph for CaBr2, CaCl2, Ca(OH)2 and MgCl2. What pH would you expect to see highest solubility? Chaz Maviyane-Davies's Global Warning is an example of art as a vehicle for:_______. Question 7 (Multiple Choice Worth 5 points)(01.03 MC)What is an advantage of a pneumatic nail gun compared to a regular hammer and nails?O it is easier to carry and store.O It uses compressed air, which helps the nails be placed more consistently and accurately.O It uses gasoline and is meant for outdoor use.O It uses pressurized liquid, which allows it to do more heavy-duty workQuestion 8 (Multiple Choice Worth 5 points) Endpoint: (0, 0), midpoint: (1,7) examples of reflex nouns f(x) = (x + 1)2What is the domain of f?